Genkartlegging. Hva er egentlig et genkart? Genetisk og fysisk kartlegging

Save this PDF as:

Størrelse: px
Begynne med side:

Download "Genkartlegging. Hva er egentlig et genkart? Genetisk og fysisk kartlegging"


1 NTNU Genkartlegging 1 Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer Hva er egentlig et genkart? Kartet over det humane genom gir oss posisjonen av de ca 25,000 genene langs de 24 kromosomene, posisjonen i forhold til hverandre, og avstanden mellom dem. To fundamentalt ulike metoder anvendes for å sette sammen genkart over kromosomer: Fysisk genkartlegging Genetisk genkartlegging 2 Genetisk og fysisk kartlegging Genetisk Fysisk På genetiske kart er avstanden et mål på prosent meiotisk overkrysning mellom to eller flere markører. Avstanden angis i centimorgan (cm). I et perfekt fysisk kart måles avstanden i antall basepar. For andre fysiske kart med lavere oppløsning er det den fysiske avstanden vi observerer ved f.eks. mikroskopi. 3 1

2 4 5 Hvorfor genkartlegging? Genkartlegging er et viktig verktøy for å kunne isolere og karakterisere gener som er av interesse i medisinsk sammenheng 6 2

3 Hvorfor er gener viktige i medisin? Inneholder oppskriften Gentest for å identifisere individer at risk Mutasjon/genvariant Kopi av oppskriften Utfører oppgaven Sykdom Informasjon om gen-produktet: Behandling/ profylakse 7 Fysisk kartlegging - metoder Kromosomfarging In situ hybridisering Celle-hybrid paneler Bacterial Artificial Chromosomes (BAC) DNA sekvensering 8 Kromosomfarging - FISH 9 Gjør det mulig å identifisere større delesjoner eller rearrangements 3

4 10 Genidentifisering - FISH Rearrangert En metafasecelle positiv for bcr/abl rearrangement (assosiert med kronisk myelogen leukemi), påvist ved hjelp av FISH. 11 Cellehybridpanel Humane kromosomer (eller deler av kromosomer) ført inn i celler fra annen art, eksempelvis fra mus eller hamster. 12 4

5 BAC (Bacterial Artificial Chromosomes) (Insert size: kb) 13 Mapping av gen til et spesifikt kromosomalt segment Små, overlappende DNA fragmenter satt inn i vektor egnet for DNA sekvensering 14 DNA sekvensering Bestemmer den eksakte rekkefølgen av baser i et DNA molekyl A - adenine C - cytosine G - guanine T - thymine 15 5

6 Genkartlegging Genetisk kartlegging Anvender koblingsanalyse (linkage analysis) for å bestemme avstanden mellom gener. 16 Koblingsanalyse Anvender genetiske markører, og studerer nedarvingen av sykdom og markører i familier Gjør det mulig å identifisere områder på kromosomer som inneholder et risiko-/sykdomsgen. Utelukke områder som ikke inneholder et risiko-/sykdomsgen. Markør 17 Risiko-gen : 8/

7 OBS!: Ulike typer arv Dominant recessiv - kjønnsbunden Pleiotropi Multiple fenotyper Epistasi - Samvirkende gener Polygen arv (kvantitative egenskaper) Ufullstendig penetrans Genotype 100/100 --> Fenotype 70/100 Maternell/paternell arv (imprinting) 19 Genetisk markør Vanligvis ikke den egentlige årsak til sykdommen Mut Markør Sykdomsgen En genetisk markør er en DNA sekvens med kjent lokalisasjon på et kromosom En genetisk markør må ha den egenskap at den kan skille imellom de to homologe kromosomene (dvs. skille mellom alleler utgaver av et gen) som vi arver fra mor og far. 20 VNTR gir opphav til flere/mange alleler GATCGATCGATCGATCGATCGATC PCR 21 Microsatellite : repetert enhet < 5 bp Minisatellite : repetert enhet bp 7

8 RFLP restriksjonsfragment lengde polymorfisme cggccg Kløyvingssete for restriksjonsenzym 22 Singel nukleotid polymorfisme (SNP) A T C G Mulige genotyper: AA AC CC (TT TG GG) 23 Koblingsanalyse Søkerettermarkørersom er tilstede hos de med en gitt sykdom (eller annen fenotype), men fraværende hos de som ikke er syke. (Dvs., det anvendes mange markører fra ulike kromosomale områder). Markøren og sykdommen sies da å være koblet, dvs. markøren er antatt å ligge i nærheten av sykdomsgenet. Utfordring: Krever DNA fra syke og friske fra samme familie Krever DNA fra mange familier Arbeids- og tidkrevende metoder 24 8

9 Homolog rekombinasjon i meiosen Sannsynligheten for at to loci skal ende opp på separate kromosom ved overkryssing er proporsjonal til avstanden mellom dem. 25 Avstanden måles i enheter kallt centi- Morgans (cm). 1 cm tilsvarer 1 recombinasjonshendelse mellom to loci pr 100 meioser (dvs. i 1% av meiosene) Genetisk koblingsanalyse v.h.a. RFLP markør 26 VNTR og RFLP markører har vært anvendt til å lage detaljerte genetiske kart over kromosomer Humane Chromosome 3 from Science Human Genetic Map, Genome Map V (Life Technologies) 27 9

10 Hvor stort er et kromosom? Kromosom 1: 263 millioner bp Kromosom 21: 50 millioner bp X: 164 millioner bp Y: 59 millioner bp 1 cm ~ 1 million bp 28 Kloning av sykdomsgener Før 1980 var bare et fåtall sykdomsloci kjent (på bakgrunn av biokjemisk karakterisering) Sykdommer som er forbundet med store kromosomale endringer var tidlig identifisert ved hjelp av fargeteknikker og mikroskopi Vi har fire grunnleggende strategier for identifikasjon og kloning av sykdomsgener Posisjonell kloning Posisjonsuavhengig kandidatgenkloning Posisjonell kandidatgenkloning Funksjonell kloning 29 Posisjonell kloning Koblingsanalyser i familier ( genom scan ved bruk av mange markører) brukes for å snevre inn området hvor sykdomsgenet er lokalisert Andre teknikker må brukes for å påvise potensielle sykdomsgen i det aktuelle området 30 genome walking / - jumping DNA sekvensering 10

11 Posisjonsuavhengig kandidatgenkloning Sykdommen kan i mange tilfeller gi indikasjon på hvilke(t) gen som er involvert Dersom man har gode kandidater vil man undersøke disse før man initierer en omfattende genetisk kartlegging Aktuelle teknikker er: Sekvensering av aktuelle gen Ekspresjonsstudier (mrna, protein) 31 Posisjonell kandidatgenkloning 32 En kombinasjon av posisjonell kloning og posisjonsuavhengeig kandidatgenkloning Sykdommen kan i mange tilfeller gi en indikasjon på hvilke(t) gen som er involvert Posisjonen av aktuelle gen(er) kan finnes i våre godt utviklete genkart Dersom denne posisjonen sammenfaller med kunnskap om sykdomslokus kan antall kandidatgen reduseres dramatisk Funksjonell kloning Kunnskap om den biokjemiske årsaken til sykdommen kan eks. brukes til: Å rense proteinet (som forårsaker sykdommen), bestemme aminosyresekvensen og syntetisere DNA probe til screening i genbibliotek. Funksjonell komplementering. Muterte celler (celler med sykdomsgen) komplementeres med humant DNA. Probe 33 11

12 Assosiasjosstudier Søker etter assosiasjon mellom genetiske markører og sykdom Som oftest Case Control studier (populasjonsbasert) Kandidatgen-, eller Genome-wide association studies (GWAS) I GWAS kan inntil 1 mill genetiske markører (SNPs), spredt gjennom hele genomet, testes samtidig 34 Affymetrix Illumina Genom-wide scan for 7 vanlige sykdommer 35 15q25 Lungekreft 36 12

13 Kloning av Cystic Fibrosis (CF) genet The CF gene was finally cloned in 1989 at an estimated cost of US$200 million and involved several research labs from several countries. Probe RFLP 1 mill bp RFLP RFLP Chr 7 Probe Probe CF-gen: > bp 24 exons mutert i pas. med CF 37 Flankerende kloner Kloner med deler av CF gen Kloning av Cystic Fibrosis (CF) genet The CF gene was finally cloned in 1989 at an estimated cost of US$200 million and involved several research labs from several countries. 38 Først funnet å være koblet til en RFLP på kromosom 7 Videre mappingstudier viste at genet lå mellom to RFLP- markører, ca 1 Mb (1 mill bp) fra hverandre. Kloner som inneholdt deler av denne regionen ble så isolert ved å benytte DNA som inneholdt RFLP-markørene som probe Disse klonene ble så brukt som prober for å isolere flankerende DNA kloner. Prosedyren gjentatt med de flankerende kloner som probe Flere kloner som til sammen inneholdt CF-genet isolert Analyse av disse, samt isolering av cdna etterfulgt av sekvensering, viste at CF-genet strekker seg over 250 kb, inneholder 24 exons og gir opphav til et mrna på ca 6 kb. DNA sekvensering viste at dette var CF genet og at det var mutert i affekterte individer. Chromosome walking 13

Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser

Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser PEDENDO_SISTE_slutt.qxd 18.12.2003 21:34 Side 32 Pediatrisk Endokrinologi 2003;17: 34-38 Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser Pål Rasmus Njølstad 1,2,3,Jørn V. Sagen


Oversikt over kap. 11. Kap. 11 Den direkte påvisning av genotype skiller individuelle genomer. Fire klasser av DNA polymorfismer.

Oversikt over kap. 11. Kap. 11 Den direkte påvisning av genotype skiller individuelle genomer. Fire klasser av DNA polymorfismer. Kap. 11 Den direkte påvisning av genotype skiller individuelle genomer Oversikt over kap. 11 Fire klasser av DNA variasjon til direkte påvisning av genotype. Metoder som bruker hybridisering, elektroforese,


Kapittel 10, del 2: Klassisk genetikk: Mendels arvelover. -forhold som influerer fenotypen slik at den avviker fra det Mendel observerte:

Kapittel 10, del 2: Klassisk genetikk: Mendels arvelover. -forhold som influerer fenotypen slik at den avviker fra det Mendel observerte: Kapittel 10, del 2: Klassisk genetikk: Mendels arvelover -forhold som influerer fenotypen slik at den avviker fra det Mendel observerte: 1. Dominansforhold 2. Multiple allel 3. Geninteraksjon 4. Genuttrykk


Oversikt over kap.10. Kap 10. Rekonstruksjon av Genomet. Splitt og overvinn strategien imøtekommer de fleste utfordringer

Oversikt over kap.10. Kap 10. Rekonstruksjon av Genomet. Splitt og overvinn strategien imøtekommer de fleste utfordringer Kap 10. Rekonstruksjon av Genomet Gjennom genetisk og molekylær analyse Oversikt over kap.10 Utfordringer og strategier ved genomanalyse Genomstørrelse Egenskaper må også analyseres Problemer med DNA polymorfismer


Bioteknologi i dag muligheter for fremtiden

Bioteknologi i dag muligheter for fremtiden Bioteknologi i dag muligheter for fremtiden Arvestoff Genetisk materiale, DNA. Baser En del av et nukleotid som betegnes med bokstavene A, C, G og T. Med disse fire bokstavene skriver DNAtrådene sine beskjeder



FLERVALGSOPPGAVER ARV FLERVALGSOPPGAVER ARV Hvert spørsmål har ett riktig svaralternativ. Arv 1 En organisme med to identiske alleler for en egenskap blir kalt A) homozygot B) dominant C) selvpollinerende D) heterozygot Arv


GRUNNLEGGENDE GENETISKE BEGREPER Del I - en serie om kattegenetikk

GRUNNLEGGENDE GENETISKE BEGREPER Del I - en serie om kattegenetikk GRUNNLEGGENDE GENETISKE BEGREPER Del I - en serie om kattegenetikk Dette er første del i en serie om kattegenetikk. I denne første delen vil jeg ta for meg de ulike genetiske begrepene som blir brukt i


Genetiske undersøkelser av biologisk materiale

Genetiske undersøkelser av biologisk materiale Genetiske undersøkelser av biologisk materiale Torunn Fiskerstrand, overlege PhD Senter for klinisk medisin og molekylærmedisin, Haukeland Universitetssykehus Institutt for klinisk medisin, Universitetet


Genetisk veiledning. Genetisk veiledning. Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer. Ulike typer gentester

Genetisk veiledning. Genetisk veiledning. Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer. Ulike typer gentester NTNU Genetisk veiledning 1 Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer Genetisk veiledning I følge Lov om medisinsk bruk av bioteknologi skal friske personer som


Kosmos SF. Figurer kapittel 8 Den biologiske tidsalderen Figur s. 214 BIOTEKNOLOGI. Næringsmiddelindustri. Landbruk. Akvakultur

Kosmos SF. Figurer kapittel 8 Den biologiske tidsalderen Figur s. 214 BIOTEKNOLOGI. Næringsmiddelindustri. Landbruk. Akvakultur Figurer kapittel 8 Den biologiske tidsalderen Figur s. 214 Proteiner fra olje og gass Bryggerier Meierivirksomhet Næringsmiddelindustri Fiskeavl Akvakultur Genmodifiserte organismer Planteavl Landbruk


Arabidopsis thaliana, vårskrinneblom

Arabidopsis thaliana, vårskrinneblom Arabidopsis thaliana, vårskrinneblom Tilhører Brassicaceae familien og ligger under ordenen Capparales. Nært beslektede planter er f. eks. raps og kål. Arabidopsis thaliana har i flere år vært en av modell


Status i forskning: Demens og arvelighet. Arvid Rongve Psykiatrisk Klinikk Helse Fonna

Status i forskning: Demens og arvelighet. Arvid Rongve Psykiatrisk Klinikk Helse Fonna Status i forskning: Demens og arvelighet Arvid Rongve Psykiatrisk Klinikk Helse Fonna Arvelighet og genetiske metoder Alzheimers sykdom og arvelighet Hva kan vi lære av de nye genene? Betydning for behandling



UNIVERSITETET I OSLO UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Eksamen i : INF2300 Grunnkurs i bioinformatikk Eksamensdag : Tirsdag 15. juni 2004 Tid for eksamen : 09.00 12.00 Oppgavesettet er på : 13


Genetikk i vår tid: Et paradigmeskifte. Kaja Selmer Avd. for medisinsk genetikk NK-SE

Genetikk i vår tid: Et paradigmeskifte. Kaja Selmer Avd. for medisinsk genetikk NK-SE Genetikk i vår tid: Et paradigmeskifte Kaja Selmer Avd. for medisinsk genetikk NK-SE Oversikt Kræsjkurs i genetikk Humangenetisk revolusjon Hvordan utreder vi barn genetisk i 2015? Et blikk mot epilepsi


Kontinuasjonseksamen, MEDSEM2/ODSEM2/ERNSEM2 høst 2007 Onsdag 20. februar 2008 kl. 09:00-15:00

Kontinuasjonseksamen, MEDSEM2/ODSEM2/ERNSEM2 høst 2007 Onsdag 20. februar 2008 kl. 09:00-15:00 Kontinuasjonseksamen, MEDSEM2/ODSEM2/ERNSEM2 høst 2007 Onsdag 20. februar 2008 kl. 09:00-15:00 A. (18) Psoriasis er en sykdom som viser multifaktoriell arv. 1. Forklar hva som menes med begrepet multifaktoriell


Hurtigtesten som utføres per i dag. Åpent møte 7 januar 2008 Gentesting ved bryst- og eggstokkreft

Hurtigtesten som utføres per i dag. Åpent møte 7 januar 2008 Gentesting ved bryst- og eggstokkreft Hurtigtest egnet for formålet? Åpent møte 7 januar 2008 Gentesting ved bryst- og eggstokkreft Overlege dr philos Torunn Fiskerstrand Haukeland Universitetssykehus Hurtigtesten som utføres per i dag 23


Hvordan standardisere en metode for isolering av plasmid til syntese av diabetes antigener?

Hvordan standardisere en metode for isolering av plasmid til syntese av diabetes antigener? Hvordan standardisere en metode for isolering av plasmid til syntese av diabetes antigener? Ranveig Østrem, Bioingeniør Hormonlaboratoriet, Aker Oslo Universitetssykehus Bakgrunn for analysen Pasienter


Obligatorisk innlevering 3kb vår 2004

Obligatorisk innlevering 3kb vår 2004 Obligatorisk innlevering 3kb vår 2004 1 I marsvin er mørk pels farge (F) dominant over albino (f), og hår (K) dominant over langt hår (k). Genene for disse to egenskapene følger prinsippet om uavhengig


Kosmos SF. Figurer kapittel 8: Den bioteknologiske tidsalderen Figur s. 234 BIOTEKNOLOGI. Næringsmiddelindustri. Landbruk.

Kosmos SF. Figurer kapittel 8: Den bioteknologiske tidsalderen Figur s. 234 BIOTEKNOLOGI. Næringsmiddelindustri. Landbruk. Figurer kapittel 8: Den bioteknologiske tidsalderen Figur s. 234 Proteiner fra olje og gass Bryggerier Meierivirksomhet Næringsmiddelindustri Fiskeavl Akvakultur Genmodifiserte organismer Planteavl Landbruk


Metode for å kartlegge DNA-et og båndmønsteret det har. Brukes for å kartlegge slektskap eller identifisere individer innenfor rettsmedisin.

Metode for å kartlegge DNA-et og båndmønsteret det har. Brukes for å kartlegge slektskap eller identifisere individer innenfor rettsmedisin. 8: Den bioteknologiske tidsalderen Figur side 238 Proteiner fra olje og gass Bryggerier Meierivirksomhet Næringsmiddelindustri Fiskeavl Akvakultur Genmodifiserte organismer Planteavl Landbruk Husdyravl


Astmagenetikk. jorrit gerritsen, Beatrix Children s Hospital, University of Groningen

Astmagenetikk. jorrit gerritsen, Beatrix Children s Hospital, University of Groningen Astmagenetikk SAMMENDRAG: jorrit gerritsen, Beatrix Children s Hospital, University of Groningen Forskningen på arvelighet ved astma og allergi har avdekket komplekse sammenhenger. Eksempelvis kan forskjellige


Kromosomer, gener og DNA

Kromosomer, gener og DNA Kromosomer, gener og DNA Hva er det, og hvordan undersøker vi det Olaug Kristin Rødningen Dr.scient, overingeniør Avdeling for medisinsk genetikk, OUS Et menneske består av ulike organsystem Organsystemene


Persontilpasset medisin. Dag Undlien Avdeling for medisinsk genetikk Oslo Universitetssykehus og Universitetet i Oslo

Persontilpasset medisin. Dag Undlien Avdeling for medisinsk genetikk Oslo Universitetssykehus og Universitetet i Oslo Persontilpasset medisin Dag Undlien Avdeling for medisinsk genetikk Oslo Universitetssykehus og Universitetet i Oslo Persontilpasset medisin skjer i norske sykehus i dag Gleevec ved leukemi Herceptin og


Svar til oppgaver i Hartwell

Svar til oppgaver i Hartwell Svar til oppgaver i Hartwell Kap.2 2.12: Hva er sjansen for at avkommet har den samme fenotype som en av de to foreldrene? a) AaBbCcDd x aabbccdd =P(A-B-C-D-) eller P(aabbccdd) = 1/2*1/2*1/2*1/2 + 1/2*1/2*1/2*1/2=2/16


Oppgave 2b V1979 Hvor i cellen foregår proteinsyntesen, og hvordan virker DNA og RNA i cellen under proteinsyntesen?

Oppgave 2b V1979 Hvor i cellen foregår proteinsyntesen, og hvordan virker DNA og RNA i cellen under proteinsyntesen? Bi2 «Genetikk» [3B] Målet for opplæringa er at elevane skal kunne gjere greie for transkripsjon og translasjon av gen og forklare korleis regulering av gen kan styre biologiske prosessar. Oppgave 2b V1979


BIOTEKNOLOGI ~ Eksempler på undervisningsaktiviteter. Fagdag ~ Gyldendal Undervisning, Mandag 31.03.2014, Ragnhild Lyngved Staberg

BIOTEKNOLOGI ~ Eksempler på undervisningsaktiviteter. Fagdag ~ Gyldendal Undervisning, Mandag 31.03.2014, Ragnhild Lyngved Staberg 1 BIOTEKNOLOGI ~ Eksempler på undervisningsaktiviteter Fagdag ~ Gyldendal Undervisning, Mandag 31.03.2014, Ragnhild Lyngved Staberg Oversikt Gi tips om praktiske aktiviteter i forhold til konkrete læreplanmål.


Klinisk molekylærmedisin (3): DNA-sekvensering

Klinisk molekylærmedisin (3): DNA-sekvensering Pediatrisk Endokrinologi 2002;16:51 56 Klinisk molekylærmedisin (3): DNA-sekvensering elge Ræder 1, Maria Ræder 2, Pål Rasmus Njølstad 1,3,4 1 Pediatrisk institutt, Universitetet i Bergen; 2 Anestesiavdelingen


Fremgangsmåte for å produsere en gnager med evne til å produsere et repertoar av kimære antistoffer eller tunge antistoffkjeder, idet fremgangsmåten

Fremgangsmåte for å produsere en gnager med evne til å produsere et repertoar av kimære antistoffer eller tunge antistoffkjeder, idet fremgangsmåten 1 Patentkrav 1. Fremgangsmåte for å produsere en gnager med evne til å produsere et repertoar av kimære antistoffer eller tunge antistoffkjeder, idet fremgangsmåten omfatter: innsetting inn i et gnagercellegenom;


Avl for auka produktivitet. QTL som nytt hjelpemiddel i avlsarbeidet.

Avl for auka produktivitet. QTL som nytt hjelpemiddel i avlsarbeidet. Avl for auka produktivitet. QTL som nytt hjelpemiddel i avlsarbeidet. Håvard Bakke Avlsmålene til SalmoBreed er: En frisk og robust fisk med gode produksjonsegenskaper. 1.Tilvekst 2. Helse 3. Kvalitet


Nye genetiske metoder for en mer effektiv overvåkning av giftproduserende cyanobakterier

Nye genetiske metoder for en mer effektiv overvåkning av giftproduserende cyanobakterier Nye genetiske metoder for en mer effektiv overvåkning av giftproduserende cyanobakterier Sigrid Haande, NIVA Fagtreff i Vannforeningen, 11.05.2009 25. mai 2009 1 Innhold Toksinproduserende cyanobakterier


Genetikkens plass i klinikken noen overordnede tanker

Genetikkens plass i klinikken noen overordnede tanker Genetikkens plass i klinikken noen overordnede tanker Trine Prescott Overlege Seksjon for klinisk genetikk Avdeling for medisinsk genetikk Oslo Universitetssykehus / Rikshospitalet 07.01.09 1 Huntington





Holder cytoplasmaet på plass. Regulerer transporten inn i og ut av cellen og har kontakt med naboceller.

Holder cytoplasmaet på plass. Regulerer transporten inn i og ut av cellen og har kontakt med naboceller. Figurer kapittel 7 Fra gen til egenskap Figur s. 189 elledel ellemembran ytoplasma Lysosom Ribosom Mitokondrie Kanalnettverk (endoplasmatisk nettverk) Kjernemembran ellekjerne rvestoff (= DN) Molekyl Protein



Kapittel 12: FRA DNA TIL PROTEIN: Kapittel 12: FRA DNA TIL PROTEIN: fra genotype til fenotype 1. Gener og polypeptider 2. DNA, RNA og informasjonsflow 3. Transkripsjon: DNA-dirigert RNA-syntese 4. Den genetiske kode 5. Aktører i Translasjon


2. Fremgangsmåten ifølge krav 1, hvori dsrna-duplekset har en lengde fra 8 basepar (bp) ti 30 bp.

2. Fremgangsmåten ifølge krav 1, hvori dsrna-duplekset har en lengde fra 8 basepar (bp) ti 30 bp. 1 Patentkrav 1. Fremgangsmåte for å endre et mål-dna, der fremgangsmåten omfatter å bringe mål-dna-et i kontakt med et kompleks omfattende: (a) et Cas9-polypeptid og (b) et enkeltmolekyl-rna som er målrettet


NTNU. Genetisk testing. Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer

NTNU. Genetisk testing. Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer NTNU Genetisk testing 1 Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer Aktuelle læringsmål: (5.1.2 beskrive de viktigste metodene innen moderne molekylærbiologi, og



FLERVALGSOPPGAVER BIOTEKNOLOGI FLERVALGSOPPGAVER BIOTEKNOLOGI FLERVALGSOPPGAVER FRA EKSAMEN I BIOLOGI 2 V2008 - V2011 Disse flervalgsoppgavene er hentet fra eksamen i Biologi 2 del 1. Det er fire (eller fem) svaralternativer i hver


Preimplantasjonsdiagnostikk PGD Hvorfor, hvordan, hva får vi vite? Arne Sunde

Preimplantasjonsdiagnostikk PGD Hvorfor, hvordan, hva får vi vite? Arne Sunde Preimplantasjonsdiagnostikk PGD Hvorfor, hvordan, hva får vi vite? Arne Sunde Leder, Fertilitetsseksjonen, St. Olavs Hospital HF, Trondheim Professor II, Cellebiologi, NTNU Genetiske tester før fødsel


Kan triste mus hjelpe i behandlingen av Huntington sykdom? Depresjon ved HS

Kan triste mus hjelpe i behandlingen av Huntington sykdom? Depresjon ved HS Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Kan triste mus hjelpe i behandlingen av Huntington sykdom? Hva kan vi lære om depresjonssymptomer


Genressurser i moderne planteforedling og forskning

Genressurser i moderne planteforedling og forskning Genressurser i moderne planteforedling og forskning Odd Arne Rognli, Institutt for plantevitenskap, NMBU 03.09.2015 Kilde: Petter Marum, Graminor Kilde: Petter Marum, Graminor Kilde: Petter Marum, Graminor


Zebrafish as a model for human development and disease. Jon Vidar Helvik

Zebrafish as a model for human development and disease. Jon Vidar Helvik Zebrafish as a model for human development and disease. Jon Vidar Helvik Mann versus fish Zebrafish is an important model for human development and disease. Most human organ system can be study on a cellular


Laboratorium for medisinsk biokjemi og blodbank.

Laboratorium for medisinsk biokjemi og blodbank. Laboratorium for medisinsk biokjemi og blodbank. LAB- nytt nr 1-2008 INNHALD: Endring av metode for analyse av s-folat Gentest ved utredning av laktoseintoleranse Vurdering av glomerulær


Født Født sånn sånn eller blitt sånn? Monica Cheng Munthe-Kaas, OUS 11.09.2013

Født Født sånn sånn eller blitt sånn? Monica Cheng Munthe-Kaas, OUS 11.09.2013 Født Født sånn sånn eller blitt blitt sånn? sånn? Monica Cheng Munthe-Kaas, OUS 11.09.2013 Innlandskongressen for Helseforskning 11 September 2013 Monica Cheng Munthe-Kaas Gener versus Miljø HJERNEVASK


Klipp og lim: Genredigering med CRISPR teknologi

Klipp og lim: Genredigering med CRISPR teknologi Klipp og lim: Genredigering med CRISPR teknologi Realfagskonferanse 4. mai 2017 Magnar Bjørås Institutt for kreftforskning og molekylærmedisin, NTNU Klinikk for laboratoriemedisin, Oslo Universitetssykehus


Ny kunnskap i avlsprogram. Anna K. Sonesson

Ny kunnskap i avlsprogram. Anna K. Sonesson Ny kunnskap i avlsprogram Anna K. Sonesson Avlsprogram Design: strategien som brukes for å forbedre genetiske anlegg Avlsverdiberegning/seleksjonskriterium Avlsmål/ definisjon av egenskaper Nye teknikker





GENER, genregulering, og genfamilier

GENER, genregulering, og genfamilier GENER, genregulering, og genfamilier 1-A, H-11 Forelesning 21.11.11 Frank Skorpen, Institutt for Laboratoriemedisin, Barne- og Kvinnesykdommer, DMF, NTNU Gener Kromosom, kromatin og DNA Hva er et gen?



UNIVERSITETET I OSLO Bokmål UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Eksamen i : INF2300 Grunnkurs i bioinformatikk Eksamensdag : Mandag 6. juni 2005 Tid for eksamen : 09.00 12.00 Oppgavesettet er på


Naturfag for ungdomstrinnet

Naturfag for ungdomstrinnet Naturfag for ungdomstrinnet Arv Illustrasjoner: Ingrid Brennhagen 1 Vi skal lære om arvestoffet, DNA celledeling genetisk variasjon arv 2 DNA Arvestoffet kalles DNA. DNA er kjempestore molekyler som inneholder



GENETISKE MEKANISMER INVOLVERT I SPREDING AV RESISTENS GENETISKE MEKANISMER INVOLVERT I SPREDING AV RESISTENS KRISTIN HEGSTAD OUTLINE Hvordan erverves nye egenskaper? Mekanismer for horisontal genoverføring (HGT) Genetiske elementer involvert i spredning Definisjoner


Genomkartlegging er det noe nyttig for havbruksnæringen?

Genomkartlegging er det noe nyttig for havbruksnæringen? Genomkartlegging er det noe nyttig for havbruksnæringen? Sigbjørn Lien Centre for Integrative Genetics (CIGENE) Institutt for husdyr- og akvakulturvitenskap (IHA) Universitetet for miljø- og biovitenskap


Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling?

Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling? Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling? Hege G. Russnes Forsker ved Avd. For Genetikk, Institutt for Kreftforskning og overlege ved Avd. For Patologi Oslo Universitetssykehus



GENTEKNOLOGISK ARBEID MED NAKENT DNA Sosial- og helsedepartementet Pb 8011 Dep. 0030 OSLO Oslo, 2. mai 1996. Ref. 96/00015-003RKA/401 GENTEKNOLOGISK ARBEID MED NAKENT DNA Det vises til brev fra Sosial- og helsedepartementet datert 6. februar


Det sitter i klisteret

Det sitter i klisteret Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Proteiner som skrur av DNA ved Huntingtons sykdom: Mer enn hva man ser ved første


Så, hvordan lager man nye nerveceller?

Så, hvordan lager man nye nerveceller? Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Å omdanne hudceller til hjerneceller: et gjennombrudd innen forskning på Huntingtons


Forelesninger i BI Cellebiologi Proteinrensing - Væskekromatografi. Figure 3-43 b

Forelesninger i BI Cellebiologi Proteinrensing - Væskekromatografi. Figure 3-43 b Proteinrensing - Væskekromatografi Figure 3-43 b Proteinrensing - Væskekromatografi Ved affinitets-kromatografi brukes en søyle med kuler som er dekket med ligander (f.eks. et enzym-substrat eller et annet


Madeleine Fannemel Avd for medisinsk genetikk

Madeleine Fannemel Avd for medisinsk genetikk Madeleine Fannemel Avd for medisinsk genetikk Norsk portal for medisinsk-genetiske analyser. Oversikt over hvilke laboratorier som gjør de ulike analyser. Avd for medisinsk genetikk


Eksamensoppgave i LGU53004 Naturfag , Emne 1 Biologi

Eksamensoppgave i LGU53004 Naturfag , Emne 1 Biologi Fakultet for lærer- og tolkeutdanning Eksamensoppgave i LGU53004 Naturfag 2 5-10, Emne 1 Biologi Faglig kontakt under eksamen: Ragnhild Lyngved Staberg Tlf.: 73 55 98 70 / 997 44 855 Eksamensdato: 28.


idet, en eller flere innskuddshendelser anvender den setespesifikke rekombinasjonen,

idet, en eller flere innskuddshendelser anvender den setespesifikke rekombinasjonen, 1 Patentkrav 1. Fremgangsmåte for å produsere en gnager med evne til å produsere et repertoar av kimære antistoffer eller tunge antistoffkjeder, idet fremgangsmåten omfatter: innsetting inn i et gnagercellegenom;


Genetisk testing. Genetisk testing. Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer

Genetisk testing. Genetisk testing. Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer NTNU Genetisk testing 1 Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer 2 Genetisk testing Formålet med genetisk testing er: finne den genetiske årsaken til tilstanden


Veileder for postnatal helgenoms kopitallsanalyser

Veileder for postnatal helgenoms kopitallsanalyser Norsk Selskap for Human Genetikk Veileder for postnatal helgenoms kopitallsanalyser Versjon 1.0 Forord Med matrisebasert kopitallsanalyse kom en ny æra i cytogenetisk diagnostikk da den gir høyere sensitivitet


Basepar i DNA. TFY4215 Innføring i kvantefysikk Øving 13 Molekylfysikk

Basepar i DNA. TFY4215 Innføring i kvantefysikk Øving 13 Molekylfysikk TFY4215 Innføring i kvantefysikk Øving 13 Molekylfysikk Basepar i DNA. Innledning DNA, deoxyribonucleic acid er molekylene som inneholder biologiske cellers genetiske informasjon. DNA er en såkalt biopolymer


Dypsekvensering. Next generation sequencing (NGS) High throughput sequencing (HTS)

Dypsekvensering. Next generation sequencing (NGS) High throughput sequencing (HTS) Dypsekvensering Next generation sequencing (NGS) High throughput sequencing (HTS) Bioingeniørkongressen 03.06.2016 Eidi Nafstad Avdelingsingeniør Avdeling for medisinsk genetikk, OUS Kromosomer og DNA


Flervalgsoppgaver: proteinsyntese

Flervalgsoppgaver: proteinsyntese Flervalgsoppgaver - proteinsyntese Hver oppgave har ett riktig svaralternativ. Proteinsyntese 1 Hva blir transkribert fra denne DNA sekvensen: 3'-C-C-G-A-A-T-G-T-C-5'? A) 3'-G-G-C-U-U-A-C-A-G-5' B) 3'-G-G-C-T-T-A-C-A-G-5'


Populasjonsgenomikk på torsk -et verktøy for identifisering av viktige genomiske regioner for oppdrettsnæringen.

Populasjonsgenomikk på torsk -et verktøy for identifisering av viktige genomiske regioner for oppdrettsnæringen. Programkonferansen HAVBRUK 2012, Stavanger, 16.-18. april 2012 Populasjonsgenomikk på torsk -et verktøy for identifisering av viktige genomiske regioner for oppdrettsnæringen. Paul R. Berga, Bastiaan Stara,


FYS3710 Molekylærbiologi

FYS3710 Molekylærbiologi 1 2 I en eukaryot celle er kromosomene festet i en indre membran som omgir en kjerne. Proteinene produseres i cellens cytoplasma. 3 I en prokaryot celle (for eksempel en bakteriecelle) er det ett kromosom.


Kap 12. Det eukaryote kromosom. En organelle for pakking og styring av DNA

Kap 12. Det eukaryote kromosom. En organelle for pakking og styring av DNA Kap 12. Det eukaryote kromosom En organelle for pakking og styring av DNA Oversikt over kapittel 12 Komponentene i et kromosom: DNA, histoner, og nonhiston proteiner Ett langt DNA molekyl og mange typer


NGS (Neste Generasjons Sekvensering) i diagnostikk, erfaringer og resultater

NGS (Neste Generasjons Sekvensering) i diagnostikk, erfaringer og resultater NGS (Neste Generasjons Sekvensering) i diagnostikk, erfaringer og resultater Emiel Janssen Seksjonsleder for Kvantitativ og Molekylær Patologi Daglig leder for laboratoriet for molekylær biologi Avdeling


Molekylærgenetiske og cytogenetiske metoder innen diagnostikk

Molekylærgenetiske og cytogenetiske metoder innen diagnostikk Molekylærgenetiske og cytogenetiske metoder innen diagnostikk FISH - påvisning av fravær/tilstedeværelse av spesifikke sekvenser - informasjon om plassering - avhengig av celler i deling Sangers sekvensering



UNIVERSITETET I OSLO UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Eksamen i : INF2300 Grunnkurs i bioinformatikk Eksamensdag : Mandag 6. juni 2005 Tid for eksamen : 09.00 12.00 Oppgavesettet er på : xx


Kapittel 14: Det eukaryote genom og dets uttrykksregulering

Kapittel 14: Det eukaryote genom og dets uttrykksregulering Kapittel 14: Det eukaryote genom og dets uttrykksregulering Innhold: 1. Det humane genom 2. Struktur av protein-kodende gener 3. RNA processering 4. Transkripsjonell kontroll 5. Posttranskripsjonell kontroll


Nytt fotopigment funnet hos fisk

Nytt fotopigment funnet hos fisk Nytt fotopigment funnet hos fisk I vår molekylære søken etter synspigmenter hos torsk ble et nytt fotopigment funnet, som tidligere ikke er kjent fra teleoster. Dette fotopigmentet hører til melanopsin


Hfr-stammer Kartlegging ved avbrutt konjugasjon (time of entry)

Hfr-stammer Kartlegging ved avbrutt konjugasjon (time of entry) BAKTERIE OG FAG GENETIKK Man studerer ofte E. coli fordi den inneholder få gener (4700 kb)sammenlihgnet med menneskets ca 6 mill kb, har kort generasjonstid (20 min) og er hele livssyklusen i haploid tilstand.


Gensaksen CRISPR - Når ivlet. Sigrid B. Thoresen, Seniorrådgiver i Bioteknologirådet

Gensaksen CRISPR - Når ivlet. Sigrid B. Thoresen, Seniorrådgiver i Bioteknologirådet Gensaksen CRISPR - Når ivlet kan l i v e t redigeres Sigrid B. Thoresen, Seniorrådgiver i Bioteknologirådet Genterapi /Genmodifisering Editing humanity The life editor The age of the red pen CRISPR, the


Molekylære mekanismer ved Alzheimers sykdom (AD)

Molekylære mekanismer ved Alzheimers sykdom (AD) Medisin stadium 1C, Geir Slupphaug, IKM Molekylære mekanismer ved Alzheimers sykdom (AD) De underliggende molekylære årsakene til AD er fremdeles mangelfullt kartlagt, men det synes nå klart at AD tilhører



FLERVALGSOPPGAVER GENETIKK FLERVALGSOPPGAVER GENETIKK FLERVALGSOPPGAVER FRA EKSAMEN I BIOLOGI 2 Disse flervalgsoppgavene er hentet fra eksamen i Biologi 2 del 1. Det er fire (eller fem) svaralternativer i hver oppgave, og bare ett


sporing av «rømt» laks med SNP-basert slektskapstesting Kjøglum S., Lien S., Kent M.; Grove H.; Lie Ø.

sporing av «rømt» laks med SNP-basert slektskapstesting Kjøglum S., Lien S., Kent M.; Grove H.; Lie Ø. Konseptbevisgenetisk sporing av «rømt» laks med SNP-basert slektskapstesting Kjøglum S., Lien S., Kent M.; Grove H.; Lie Ø. Bakgrunn Myndigheter, NGO-er og FHL vil ansvarlig gjøre norske oppdrettere for


10/8/2013. video1. Progressive axonopathy (PA) Diagnostiske tester. Patellar refleks. Plasserings refleks

10/8/2013. video1. Progressive axonopathy (PA) Diagnostiske tester. Patellar refleks. Plasserings refleks Progressive axonopathy (PA) en sykdom i nervesystemet som begrensen hundens evne til å kontrollere bevegelsene sine Patellar refleks Diagnostiske tester Plasserings refleks erve konduktivitet (evne til


Den genetiske revolusjon til nytte for meg?

Den genetiske revolusjon til nytte for meg? Den genetiske revolusjon til nytte for meg? Gunnar Houge Seksjonsleder/overlege Senter for medisinsk genetikk og molekylærmedisin Haukeland Universitetssykehus Hvor ofte har utviklingshemning genetisk


Identifisering av en genvariant som viser sterk sammenheng med kullstørrelse hos norsk kvit sau.

Identifisering av en genvariant som viser sterk sammenheng med kullstørrelse hos norsk kvit sau. Identifisering av en genvariant som viser sterk sammenheng med kullstørrelse hos norsk kvit sau. DAG INGE VÅGE 1, MAREN HUSDAL 1, MATTHEW PETER KENT 1, GUNNAR KLEMETSDAL 1, THOR BLICHFELDT 2 OG INGER ANNE


Sammenligningen mellom Arabidopsis thaliana genomet og de kjente genomene fra cyanobakterier, gjær, bananflue og nematode, viser bl. a.

Sammenligningen mellom Arabidopsis thaliana genomet og de kjente genomene fra cyanobakterier, gjær, bananflue og nematode, viser bl. a. Sammenligningen mellom Arabidopsis thaliana genomet og de kjente genomene fra cyanobakterier, gjær, bananflue og nematode, viser bl. a. Antall gener som er involvert i cellulær kommunikasjon og signaloverføring


Genetikk og persontilpasset medisin Ny teknologi nye muligheter og nye utfordringer

Genetikk og persontilpasset medisin Ny teknologi nye muligheter og nye utfordringer Genetikk og persontilpasset medisin Ny teknologi nye muligheter og nye utfordringer Dag Undlien Avdeling for medisinsk genetikk Oslo Universitetssykehus Dep of Medical Genetics


Eksamensoppgåve i LGU53004 Naturfag , Emne 1 Biologi

Eksamensoppgåve i LGU53004 Naturfag , Emne 1 Biologi Fakultet for lærar- og tolkeutdanning Eksamensoppgåve i LGU53004 Naturfag 2 5-10, Emne 1 Biologi Fagleg kontakt under eksamen: Ragnhild Lyngved Staberg Tlf.: 73 55 98 70 / 997 44 855 Eksamensdato: 28.


Blau Syndrom/ Juvenil Sarkoidose

Blau Syndrom/ Juvenil Sarkoidose Blau Syndrom/ Juvenil Sarkoidose Versjon av 2016 1. HVA ER BLAU SYNDROM/ JUVENIL SARKOIDOSE 1.1 Hva er det? Blau syndrom er en genetisk sykdom. Sykdommen gir


Disseksjon av genetikken ved multifaktoriell sykdom Type 1 diabetes som modell

Disseksjon av genetikken ved multifaktoriell sykdom Type 1 diabetes som modell Norsk Epidemiologi 2002; 12 (2): 131-135 131 Disseksjon av genetikken ved multifaktoriell sykdom Type 1 diabetes som modell Kjersti Skjold Rønningen Divisjon for epidemiologi, Nasjonalt folkehelseinstitutt,



UNIVERSITETET I AGDER FAKULTET FOR TEKNOLOGI OG REALFAG EKSAMEN Emnekode: BI0105 Emnenavn: Genetikk og evolusjon Dato: 21. november 2011 Varighet: 2 timer Antall sider inkl. forside 8 Tillatte hjelpemidler: Kalkulator Merknader:


Det humane genomet. (genom = arvemasse) 3 x 10 9 basepar. ca. 30.000 gen. ferdigsekvensert ca. år 2001

Det humane genomet. (genom = arvemasse) 3 x 10 9 basepar. ca. 30.000 gen. ferdigsekvensert ca. år 2001 Det humane genomet (genom = arvemasse) 3 x 10 9 basepar ca. 30.000 gen ferdigsekvensert ca. år 2001 kromosom 21 127 kjente gen 98 ukjente gen Biologi cellekultur organ organismar kva gen er involvert i


Figurer kapittel 8: Bioteknologi Figur s

Figurer kapittel 8: Bioteknologi Figur s 2 Figurer kapittel 8: Bioteknologi Figur s. 236 237 5' 3' 5' 3' DNA-primer 5' 3' DNA bit som skal kopieres Oppvarming 3' 5' 5' DNAprimer tilsettes 3' 3' 5' DNApolymerase Nytt DNA dannes Kopieringen gjentas


CAG repetisjoner og gråsonen

CAG repetisjoner og gråsonen Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Hvor lang er for lang? Nye tanker om "gråsonen" ved Huntington sykdom Kan et middels


Hvilke medisinske behov har vi løst om 10 år?

Hvilke medisinske behov har vi løst om 10 år? Hvilke medisinske behov har vi løst om 10 år? Gry Fluge Vindedal, PhD Medisinsk rådgiver, nevrologi AbbVie AGENDA - Nevrologiens kompleksitet - «The crisis» innen den farmasøytiske industrien - Fremtidens


Vegard Eldholm. Molekylær TB epidemiologi

Vegard Eldholm. Molekylær TB epidemiologi Vegard Eldholm Molekylær TB epidemiologi Molekylærepidemiologiske metoder Sannsynliggjøre eller avkrefte transmisjonslinker mellom TB pasienter. Avdekke krysskontaminasjon i laboratoriet Skille reinfeksjon


Født sånn eller blitt sånn: om gener, søppel-dna og epigenetikk

Født sånn eller blitt sånn: om gener, søppel-dna og epigenetikk Født sånn eller blitt sånn: om gener, søppel-dna og epigenetikk Dag O. Hessen University of Oslo, Dept. Biology Center of Ecological and Evolutionary Synthesis (CEES) Kappløpet et (kort) historisk tilbakeblikk



FAKULTET FOR TEKNOLOGI OG REALFAG EKSAMEN g UNIVERSITETET I AGDER FAKULTET FOR TEKNOLOGI OG REALFAG EKSAMEN Emnekode: BI0105 Emnenavn: Genetikk og evolusjon Dato: 7. mai 2012 Varighet: 4 timer Antall sider inkl. forside 8 Tillatte hjelpemidler:


Genetiske analyser i genetisk epidemiologi

Genetiske analyser i genetisk epidemiologi Norsk Epidemiologi 2002; 12 (2): 89-96 89 Genetiske analyser i genetisk epidemiologi Anne Spurkland og Hanne Flinstad Harbo Immunologisk institutt, Rikshospitalet, 0027 Oslo Korresponderende forfatter:


Psykisk utviklingshemming. Gertraud Leitner Barnelege HABU SSK

Psykisk utviklingshemming. Gertraud Leitner Barnelege HABU SSK Gertraud Leitner Barnelege HABU SSK Utredning Anamnese Familie Svangerskap, fødsel Utvikling Sykdommer Informasjon fra skolen og barnehagen Klinisk undersøkelse Avdekke tilstander Utseende: spesielle kjennetegn


Genetikk og bioteknologi. Litt historikk et perspektiv. Forelesning # 6. Publiserte genomsekvenser (2003) Bioteknologi etableres... Lars O.

Genetikk og bioteknologi. Litt historikk et perspektiv. Forelesning # 6. Publiserte genomsekvenser (2003) Bioteknologi etableres... Lars O. Genetikk og bioteknologi Forelesning # 6 Lars O. Baumbusch Senter for Bioinformatikk, IFI, UiO Rikshospitalet - Radiumhospitalet Medical Centre Lars O. Baumbusch INF3350/INF4350 Høst 2007 1 Litt historikk


BINGO - Kapittel 1. kroppsceller hos menn (XY) Arvelærens far (G. J. Mendel) Forkortelse for genmodifiserte organismer (GMO)

BINGO - Kapittel 1. kroppsceller hos menn (XY) Arvelærens far (G. J. Mendel) Forkortelse for genmodifiserte organismer (GMO) BINGO - Kapittel 1 Bingo-oppgaven anbefales som repetisjon etter at kapittel 1 er gjennomgått. Klipp opp tabellen (nedenfor) i 24 lapper. Gjør det klart for elevene om det er en sammenhengende rekke vannrett,


Hvor er responsen når vi ikke bruker den? Tore Vignes og Stein Evensen

Hvor er responsen når vi ikke bruker den? Tore Vignes og Stein Evensen Hvor er responsen når vi ikke bruker den? Tore Vignes og Stein Evensen Responser Noen bruker vi hele tiden Noen bruker vi sjelden Noen har vi nesten ikke brukt! Where is the f.. response!? Klasser Funksjonelle


Immunstimulanter for potensiering av torskens naturlige immunsystem

Immunstimulanter for potensiering av torskens naturlige immunsystem Store programmer HAVBRUK - En næring i vekst Faktaark Immunstimulanter for potensiering av torskens naturlige immunsystem Prosjekt: Immunostimulation of Atlantic cod (Gadus
