Den genetiske revolusjon til nytte for meg?

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Begynne med side:

Download "Den genetiske revolusjon til nytte for meg?"

Transkript

1 Den genetiske revolusjon til nytte for meg? Gunnar Houge Seksjonsleder/overlege Senter for medisinsk genetikk og molekylærmedisin Haukeland Universitetssykehus

2 Hvor ofte har utviklingshemning genetisk årsak (i Norge)? A: < 30% B: ~ 60% C: > 90 % Hvilket tall er nærmest gjennomsnittlig gjentagelsesrisiko hvis friske foreldre får et barn med PU? A: ~ 1% B: ~ 25 % C: ~ 50 % Er økt sårbarhet for psykiatrisk sykdom og atferdsavvik vanlig ved de fleste kromosom- og genfeil? A: Ja B: Nei

3 ~6 % har en sjelden genetisk sykdom - de fleste mangler årsaksdiagnose - mange ubeskrevne tilstander - rundt halvparten er medfødte utviklingsavvik - utviklingsavvik skyldes vanligvis nyopppståtte feil (dersom foreldre ikke er nært beslektet)

4 Det sjeldne er hyppig 1-2% av alle barn har alvorlige medfødte utviklingsavvik med PU +/- misdannelser Kromosomfeil påvises hos ~1/4: Synlige kromosomfeil påvises hos ~7 % Usynlig kromosomfeil påvises hos 2-3 ganger flere Genfeil påvises hos drøyt 1/4, de fleste de novo I knapt halvparten av tilfellene (40 %) er årsaken til utviklingsavviket (fortsatt) ukjent

5 Genomet i mikroskopet: Kromosomene Et kromosom= Sammenkrøllet DNA tråd pakket inn av kromatin Rundt 3 % av genomet er gener : ~ for proteiner og ~ for RNA

6 Kromosomstruktur Kromatin

7 DNA-test Klassisk kromosom-test (lysmikroskopi)

8 ACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGG TACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGT GACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAG TCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTCC CCCCCTTTTAAAAGGTTACCCGGGGTACTGTAGCACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGAC GTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTTGACGTACGTACCCGGGGGTTAACGTACGGACCCTTAGGTAC GGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGAC GTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTGTACTTGAAGTCACCGCTAGTCCCCCCCTTTTAAAAGGTTACC 1 CGGGGTACTGTAGCACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGAACGGACCTAGACCGTAACGTTGACCGTGAC CGTTTGGTTGGACCTAGACCGTAACGTTGACCGTGACCGTTTGGTTAACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTAC Ekson GGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGAC GTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCA CCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGA CCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTCCCCCCCTTTTAAAAGGTTGTCCGGGGTACTGTAGCACGGACCCTTAGGTACGGATCCTAGTGACGTA CTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCG CTAGTTGACGTACGTACCCGGGGGTTAACGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTA CTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCG CTAGTGTACTTGAAGTCACCGCTAGTCCCCCCCTTTTAAAAGGTTACCCGGGGTACTGTAGCACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTA CGGACCCTTAGGTACGAACGGACCTAGACCGTAACGTTGACCGTGACCGTTTGGTTGGACCTAGACCGTAACGTTGACCGTGACCGTTTGGTTAACGGACCCTTAGGTACGG ATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGT ACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACC GCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACC CTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTCCCCCCCTTTTAAAAGGTTAC CCGGGGTACTGTAGCACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTA Intron GTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTTGACGTACGTACCCGGGGGTTAACGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTT GAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTA GTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTGTACTTGAAGTCACCGCTAGTCCCCCCCTTTTAAAAGGTTACCCGGGGTACTGTAGCACGG ACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGAACGGACCTAGACCGTAACGTTGACCGTGACCGTTTGGTTGGACCTAGAC CGTAACGTTGACCGTGACCGTTTGGTTAACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTT GAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTA GTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTA GGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTA GTGACGTACTTGAAGTCACCGCTAGTCCCCCCCTTTTAAAAGGTTACCCGGGGTACTGTAGCACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTA CGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTTGACGTACGTACCC GGGGGTTAACGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTA CGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTGTACTTGAAGTCAC CGCTAGTCCCCCCCTTTTAAAAGGTTACCCGGGGTACTGTAGCACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGAAC GGACCTAGACCGTAACGTTGACCGTGACCGTTTGGTTGGACCTAGACCGTAACGTTGACCGTGACCGTTTGGTTAACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAA GTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTA 2 CGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGT ACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTG ACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACAGGAAGTCACCGCTAGTCCCCCCCTTTTAAAAGGTTACCCGGGGTACTGTAGCACGG ACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTACG GATCCTAGTGACGTACTTGAAGTCACCGCTAGTTGACGTACGTACCCGGGGGTTAACGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGG

9 ACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTA GTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCT AGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCG CTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACC GCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCAC CGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCA CCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTC ACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGT VUS CACCGCTAGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAA GTCACCGCTAGTCCCCCCCTTTTAAAAGGTTACCCGGGGTACTGTAGC ACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCTA Variant of Unknown GTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCGCT Significance AGTACGGACCCTTAGGTACGGATCCTAGTGACGTACTTGAAGTCACCG CTAGTTGACGTACGTACCCGGGGGTTAACGTACGGACCCTTAGGTACG GATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTAC GGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGTA CGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTACGGACCCTTAGGT ACGGATCCTAGTGACGTACTTGAAGTCACCGCTAGTGTACTTGAAGTCA

10 1q q p11.2 En genetikers organsystem

11 Fakta om genomet Til sammen 2 m lang DNA tråd 1,5 % (3 cm) utgjøres av proteinkodende gener ~ proteinkodende gener (= gener ) Resten av genomet (> 98 %) regulerer disse genene Alle gener kan i dag undersøkes samtidig men ikke gjør det uten at du vet hva du ser etter Vi er alle fulle av sjeldne genvarianter!

12 Viktige genetiske begreper Allel Homozygot Heterozygot Mutasjon Dominant Recessiv Genotype Fenotype - et gen eller en DNA sekvens variant - identiske alleler - ulike alleler - en variant som kan gi sykdom/avvik - ett mutert allel kan gi sykdom/avvik - begge alleler må være ødelagt - allel- og variantsammensetningen - det kliniske bildet (sympt & funn)

13 Genotype Fenotype Ulike feil i samme gen kan gi ulike sykdommer Samme sykdom (fenotype) kan skyldes feil i ulike gener (genetisk heterogenisitet) Fenokopier: Samme sykdom kan ha ukjente genetiske eller miljømessige årsaker Vanskelig å forutsi fenotypen til en genotype

14 Penetrans og ekspressivitet Penetrans (~gjennomslagskraft): Aldersavhengig sannsynlighet for at en genfeil (mutasjon) skal føre til sykdom Ekspressivitet (~sykdomsutbredelse): Grad av sykdom forårsaket av en gitt genfeil Typisk for mange sårbarhetsvarianter : Moderat penetrans og variabel ekspressivitet

15 Tre årsaker til genetisk sykdom: 1) Genomisk ubalanse: kopitallsendring - kromosomfeil - ødeleggende genfeil (loss-of-function) 2) Genfunksjonforstyrrelse: egenskapsendring - aktiverende mutasjoner (gain-of-function) - forstyrrende mutasjoner (dominant-negative) 3) Feilregulering: strukturendring og epigenetikk - genomiske sykdommer (de fleste ukjente)

16 De fleste genetiske sykdommer er ikke arvelige: Antall nyoppsåtte forandringer per generasjon: Eksom 1 2 Genom 30 80

17 Genetisk Arvelig De fleste utviklingsavvik og genetiske tilstander slyldes nyoppståtte gen- eller kromosomfeil

18 Fosterlivet er et mutasjonsfilter: Utfall: Okkult abort (>50%?) Tidlig abort (40-50%) Tilfeldige genotyper Sen abort (5-40%) Dødfødsel (~5%) Neonatal død (~5%) Fosterlivet Fenotyper Omtrent 1 av 250 nyfødte har en synlig ubalansert karyotype, ~1/2 kjønnskromosomavvik og ~1/4 trisomi 21

19 Milde kromosomfeil kan overleve til fødsel 13, 18, 21 og Y er genfattige kromosomer (med hhv ~3,5, ~ 4,5 og ~5,5 gener per megabase mot normalt ~30)

20 Mosaisisme er vanlig og vanskelig Epiblast ~9 mnd Mosaisisme - når noe går galt på veien...

21 Hva skal en utrede ved lærevansker/pu og store atferdsavvik/adhd/asd? Dersom PU: Høypenetrante kromosomfeil og genfeil Gjør: Kopitallsundersøkelse Vurder: Klinisk-genetisk syndromutredning Lærevansker/ADHD/ASD: Sårbarhetsvarianter Gjør: Analyse for rekurrente kopitallsavvik og kjønnskromosomavvik Vurder: Enkel familieutredning

22 Sårbarhetsavvik Mange med rekurrente kopitallsvarianter og kjønnskromosomavvik har økt sårbarhet for Hyperaktivitet (ADHD) Adferdsforstyrrelser Autismespektertilstander (ASD) Lærevansker, sjeldnere mild PU

23 Hyppige rekurrente kopitallsavvik Del 22q11.2 DiGeorge syndrom = velocardiofacialt syndrom Del/dup 16p11.2 Gir risiko for lærevansker, psykiatri og over/under-vekt Del 15q13.3 Gir sårbarhet for lærevansker, epilepsi og adferdsavvik Del/dup 1q21.1 Gir sårbarhet for lærevansker og adfredsavvik

24 DiGeorge syndrom, del 22q11.2 Insidens 1 : 4000 Medfødt hjertefeil (~50 %), lav kalsium, immunforstyrrelser, ganeseilsproblemer Lærevansker (70-90 %) ASD hos 20 % av barn Betydelig psykiatrisk sykdom (schizofreni o.a.) hos 25 % av voksne ADD, angst, sosiale samspillsvansker

25 15q13.3 delesjon 1 : 2000? Lærevansker / lett PU Epilepsi Autisme, psykisk sykdom, adferdsproblem Kan være nedarvet. Variabel ekspresivitet!

26 16q11.2 avvik (~1:2000?) Delesjon: ~10 % nedarvet (som ved DiGeorge) Lærevansker/PU samt ASD Stort hode/makrocefali Overvekt (minner om Prader-Willi). Duplikasjon: Lærevansker, psykiatri (schizofreni o.a.) Relativt lite hode (relativt sett) Slank/undervektig

27 For mange kjønnskromosom er vanlig Insidens: 1:600 XXY, 1:1000 XXX, 1:1000 XYY Økt sårbarhet for lærevansker: XXX > XXY ~ XYY Dersom 4-5 kjønnskromosom er PU vanlig XYY er assosiert med ADHD XXX og XYY er normalt fertile, XXY er infertil Alle med > 2 kjønnskromosom blir relativt storvokste

28 Eldre fedre har økt risiko for å få barn med psykiatrisk sykdom ~3 ganger økt risiko for schizofreni/autisme hvis far er > 45 år enn i aldersgruppen år Testiklene er kilden til de fleste mutasjoner ( genfeil ) Eggstokkene er kilden til de fleste numeriske kromosomfeil (av typen Down syndrom)

29 Hva med next generation sekvensering? (NGS, også kalt HTS, dypsekvensering) Prinsipp: sekvenserer alle gener (hele eksomet) eller en utvalgt genpakke Filtrerer for nyoppstått dominant eller recessiv sykdom Trenger foreldreprøver for å filtrere dersom det er mange kandidatgener (= trio-ngs) Kostnad: ~ for singelprøve, ~ for trio Refiltrering mulig (dersom nye gener dukker opp) Potensiell ulempe: Insidente funn (risiko < 1 %)

30

31

32 Noen eksempler Jente 3 mnd gml med normalt blikk, AMC/opistotonus, ødemer og normal hjerne-mr: PÅVIST nyoppstått mutasjon i BICD2, D: SMALED Gutt 2 år med PU/hypotoni, behandlingsresistent epilepsi og normal hjerne-mr: PÅVIST nyoppstått mutasjon i GABRB1, et subenhet av ionekanaler i GABA-reseptorfamilien Jente 8 år med PU, epilepsi, ustøhet og dysmorfe ansiktstrekk: PÅVIST sammensatt heterozgoti for to nedarvede mutasjoner i CLCN2, en kloridkanal i hjernen, en kjent årsak til leukoencefalopati med ataksi

33 Hvor gode diagnostikere er vi? Gjette på årsaksgenet: Vanskelig - selv for eksperter Selv om alt gjøres påvises en genetisk årsak kun i drøyt halvparten av sjeldentilfellene

34 Fra $ til $ 1000 per genom hjeper lite når boken er gresk for oss: Jmfr 1. Korinterbrev kapittel 13 9 For vi forstår stykkevis og taler profetisk stykkevis 10 Men når det fullkomne kommer, skal det som er stykkevis, ta slutt

35 6% community klinikken: Syndromer og Kromosomfeil < 2K genetiker 10% 60% Okkult Mosaisisme Epigenetikk & strukturell Genomikk 80% Next generation genetiker

36 Systematisk og internasjonal datainnsamling er nødvendig for å forstå genome

37 Vårt genom dynamisk Tilfeldige og nyoppståtte feil er hyppigste årsak til utviklingsavvik og genetisk sykdom Det finnes ~7000 sjeldne genetiske sykdommer som tilsammen affiserer ~6 % av befolkningen P.t. kan drøyt halvparten av barn med uforklarlig utviklingshemning få en årsaksdiagnose

38

Genetikk i vår tid: Et paradigmeskifte. Kaja Selmer Avd. for medisinsk genetikk NK-SE

Genetikk i vår tid: Et paradigmeskifte. Kaja Selmer Avd. for medisinsk genetikk NK-SE Genetikk i vår tid: Et paradigmeskifte Kaja Selmer Avd. for medisinsk genetikk NK-SE Oversikt Kræsjkurs i genetikk Humangenetisk revolusjon Hvordan utreder vi barn genetisk i 2015? Et blikk mot epilepsi

Detaljer

Dypsekvensering. Next generation sequencing (NGS) High throughput sequencing (HTS)

Dypsekvensering. Next generation sequencing (NGS) High throughput sequencing (HTS) Dypsekvensering Next generation sequencing (NGS) High throughput sequencing (HTS) Bioingeniørkongressen 03.06.2016 Eidi Nafstad Avdelingsingeniør Avdeling for medisinsk genetikk, OUS Kromosomer og DNA

Detaljer

Psykisk utviklingshemming. Gertraud Leitner Barnelege HABU SSK

Psykisk utviklingshemming. Gertraud Leitner Barnelege HABU SSK Gertraud Leitner Barnelege HABU SSK Utredning Anamnese Familie Svangerskap, fødsel Utvikling Sykdommer Informasjon fra skolen og barnehagen Klinisk undersøkelse Avdekke tilstander Utseende: spesielle kjennetegn

Detaljer

Madeleine Fannemel Avd for medisinsk genetikk

Madeleine Fannemel Avd for medisinsk genetikk Madeleine Fannemel Avd for medisinsk genetikk www.genetikkportalen.no/ Norsk portal for medisinsk-genetiske analyser. Oversikt over hvilke laboratorier som gjør de ulike analyser. Avd for medisinsk genetikk

Detaljer

Status i forskning: Demens og arvelighet. Arvid Rongve Psykiatrisk Klinikk Helse Fonna

Status i forskning: Demens og arvelighet. Arvid Rongve Psykiatrisk Klinikk Helse Fonna Status i forskning: Demens og arvelighet Arvid Rongve Psykiatrisk Klinikk Helse Fonna Arvelighet og genetiske metoder Alzheimers sykdom og arvelighet Hva kan vi lære av de nye genene? Betydning for behandling

Detaljer

Universitetssykehuset

Universitetssykehuset Psykisk utviklingshemming. Avd. overlege Arve Kristiansen Avdeling for spesialisert habilitering. Universitetssykehuset Nord-Norge Harstad Narvik 26. mars 2009 Medisinske betegnelser (ICD-10) Mental retardasjon.

Detaljer

Molekylærgenetiske og cytogenetiske metoder innen diagnostikk

Molekylærgenetiske og cytogenetiske metoder innen diagnostikk Molekylærgenetiske og cytogenetiske metoder innen diagnostikk FISH - påvisning av fravær/tilstedeværelse av spesifikke sekvenser - informasjon om plassering - avhengig av celler i deling Sangers sekvensering

Detaljer

Kromosomer, gener og DNA

Kromosomer, gener og DNA Kromosomer, gener og DNA Hva er det, og hvordan undersøker vi det Olaug Kristin Rødningen Dr.scient, overingeniør Avdeling for medisinsk genetikk, OUS Et menneske består av ulike organsystem Organsystemene

Detaljer

Har jeg arvelig disposisjon for hjertesykdom?

Har jeg arvelig disposisjon for hjertesykdom? Har jeg arvelig disposisjon for hjertesykdom? Nina Øyen Senter for medisinsk gene?kk og molekylærmedisin, Haukeland universitetssykehus & Ins?tuE for global helse og samfunnsmedisin, Universitetet i Bergen

Detaljer

FLERVALGSOPPGAVER ARV

FLERVALGSOPPGAVER ARV FLERVALGSOPPGAVER ARV Hvert spørsmål har ett riktig svaralternativ. Arv 1 En organisme med to identiske alleler for en egenskap blir kalt A) homozygot B) dominant C) selvpollinerende D) heterozygot Arv

Detaljer

Genetikkens plass i klinikken noen overordnede tanker

Genetikkens plass i klinikken noen overordnede tanker Genetikkens plass i klinikken noen overordnede tanker Trine Prescott Overlege Seksjon for klinisk genetikk Avdeling for medisinsk genetikk Oslo Universitetssykehus / Rikshospitalet 07.01.09 1 Huntington

Detaljer

Translasjonsforskning i utviklingsforstyrrelser status og muligheter i Norge

Translasjonsforskning i utviklingsforstyrrelser status og muligheter i Norge Translasjonsforskning i utviklingsforstyrrelser status og muligheter i Norge Ole A. Andreassen NORMENT, KG Jebsen Senter for Psykoseforskning Klinikk psykisk helse og avhengighet, Institutt for klinisk

Detaljer

Oppgave 2b V1979 Hvor i cellen foregår proteinsyntesen, og hvordan virker DNA og RNA i cellen under proteinsyntesen?

Oppgave 2b V1979 Hvor i cellen foregår proteinsyntesen, og hvordan virker DNA og RNA i cellen under proteinsyntesen? Bi2 «Genetikk» [3B] Målet for opplæringa er at elevane skal kunne gjere greie for transkripsjon og translasjon av gen og forklare korleis regulering av gen kan styre biologiske prosessar. Oppgave 2b V1979

Detaljer

Down syndrom, fredag 8.april.

Down syndrom, fredag 8.april. Down syndrom, fredag 8.april. Livsprognose Gj.alder: > 60 år. 1900 2-4 år 1970 ca. 35 år Siste 30 år, en fordobling av mennesker med DS > 30 års alder Mye forskning på Tr 21 i utvikling (hjerne) Mye forskning

Detaljer

Blau Syndrom/ Juvenil Sarkoidose

Blau Syndrom/ Juvenil Sarkoidose www.printo.it/pediatric-rheumatology/no/intro Blau Syndrom/ Juvenil Sarkoidose Versjon av 2016 1. HVA ER BLAU SYNDROM/ JUVENIL SARKOIDOSE 1.1 Hva er det? Blau syndrom er en genetisk sykdom. Sykdommen gir

Detaljer

Periodisk NLRP 12-Forbundet Feber

Periodisk NLRP 12-Forbundet Feber www.printo.it/pediatric-rheumatology/no/intro Periodisk NLRP 12-Forbundet Feber Versjon av 2016 1. HVA ER PERIODISK NLRP 12-FORBUNDET FEBER 1.1 Hva er det? Sykdommen er arvelig. Det endrede genet ansvarlig

Detaljer

Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser

Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser PEDENDO_SISTE_slutt.qxd 18.12.2003 21:34 Side 32 Pediatrisk Endokrinologi 2003;17: 34-38 Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser Pål Rasmus Njølstad 1,2,3,Jørn V. Sagen

Detaljer

Autismespekterforstyrrelser Sentrale utfordringer

Autismespekterforstyrrelser Sentrale utfordringer 1 Modeller for å forstå Sentrale utfordringer Terje Nærland Psykolog / PhD Forsker: Leder: NevSom Nasjonal kompetansesenter for nevroutviklingsforstyrrelser og hypersomnier, OUS SFF NORMENT - K.G. Jebsen

Detaljer

Veileder for postnatal helgenoms kopitallsanalyser

Veileder for postnatal helgenoms kopitallsanalyser Norsk Selskap for Human Genetikk Veileder for postnatal helgenoms kopitallsanalyser Versjon 1.0 Forord Med matrisebasert kopitallsanalyse kom en ny æra i cytogenetisk diagnostikk da den gir høyere sensitivitet

Detaljer

Genetiske undersøkelser av biologisk materiale

Genetiske undersøkelser av biologisk materiale Genetiske undersøkelser av biologisk materiale Torunn Fiskerstrand, overlege PhD Senter for klinisk medisin og molekylærmedisin, Haukeland Universitetssykehus Institutt for klinisk medisin, Universitetet

Detaljer

Tidlig ultralyd i svangerskapet - drøftingssak til Nasjonalt råd. Tidlig ultralyd i svangerskapet 1

Tidlig ultralyd i svangerskapet - drøftingssak til Nasjonalt råd. Tidlig ultralyd i svangerskapet 1 Tidlig ultralyd i svangerskapet - drøftingssak til Nasjonalt råd Tidlig ultralyd i svangerskapet 1 Ulike diskusjoner om tidlig ultralyd en diskusjon om medisinskfaglige aspekter - helsemessig betydning

Detaljer

Kjennetegn på autisme, årsaker, forklaringsmodeller. Eirik Nordmark Spesialist nevropsykologi Barnehabiliteringen, autismeteamet

Kjennetegn på autisme, årsaker, forklaringsmodeller. Eirik Nordmark Spesialist nevropsykologi Barnehabiliteringen, autismeteamet Kjennetegn på autisme, årsaker, forklaringsmodeller Eirik Nordmark Spesialist nevropsykologi Barnehabiliteringen, autismeteamet Kjennetegn = Diagnose Autisme er definert i diagnosemanualene ICD-10 og DSM-V

Detaljer

Preimplantasjonsdiagnostikk PGD Hvorfor, hvordan, hva får vi vite? Arne Sunde

Preimplantasjonsdiagnostikk PGD Hvorfor, hvordan, hva får vi vite? Arne Sunde Preimplantasjonsdiagnostikk PGD Hvorfor, hvordan, hva får vi vite? Arne Sunde Leder, Fertilitetsseksjonen, St. Olavs Hospital HF, Trondheim Professor II, Cellebiologi, NTNU Genetiske tester før fødsel

Detaljer

Hurtigtesten som utføres per i dag. Åpent møte 7 januar 2008 Gentesting ved bryst- og eggstokkreft

Hurtigtesten som utføres per i dag. Åpent møte 7 januar 2008 Gentesting ved bryst- og eggstokkreft Hurtigtest egnet for formålet? Åpent møte 7 januar 2008 Gentesting ved bryst- og eggstokkreft Overlege dr philos Torunn Fiskerstrand Haukeland Universitetssykehus Hurtigtesten som utføres per i dag 23

Detaljer

Psykiatrisk komorbiditet ved ASD klinisk betydning og diagnostiske utfordringer. Tønsbergkonferansen, 02. juni 2016

Psykiatrisk komorbiditet ved ASD klinisk betydning og diagnostiske utfordringer. Tønsbergkonferansen, 02. juni 2016 Psykiatrisk komorbiditet ved ASD klinisk betydning og diagnostiske utfordringer Tønsbergkonferansen, 02. juni 2016 Elen Gjevik, konst. overlege, PhD BUPsyd, Oslo universitetssykehus Innhold Fenomenet komrobiditet

Detaljer

Mevalonate Kinase Mangel (MKD) ( Hyper IgD syndrom)

Mevalonate Kinase Mangel (MKD) ( Hyper IgD syndrom) www.printo.it/pediatric-rheumatology/no/intro Mevalonate Kinase Mangel (MKD) ( Hyper IgD syndrom) Versjon av 2016 1. HVA ER MKD 1.1 Hva er det? Mevalonat kinase-mangel er en genetisk sykdom. Det er en

Detaljer

om Autismespekterforstyrrelser og genetiske syndromer

om Autismespekterforstyrrelser og genetiske syndromer Fragilt-X-Syndrom Kort informasjon Fagdag g om Autismespekterforstyrrelser og genetiske syndromer Helse Midt-Norge Stjørdal 24. oktober 2011 David K. Bergsaker Overlege Frambu Noen tankevekkende fakta

Detaljer

Oversikt over kap. 11. Kap. 11 Den direkte påvisning av genotype skiller individuelle genomer. Fire klasser av DNA polymorfismer.

Oversikt over kap. 11. Kap. 11 Den direkte påvisning av genotype skiller individuelle genomer. Fire klasser av DNA polymorfismer. Kap. 11 Den direkte påvisning av genotype skiller individuelle genomer Oversikt over kap. 11 Fire klasser av DNA variasjon til direkte påvisning av genotype. Metoder som bruker hybridisering, elektroforese,

Detaljer

Kortvoksthet og vekstretardasjon

Kortvoksthet og vekstretardasjon Kortvoksthet og vekstretardasjon Robert Bjerknes Barneklinikken, Haukeland Universitetssykehus og Seksjon for Pediatri, Klinisk institutt 2, Universitetet i Bergen VEKSTRETARDASJON OG KORTVOKSTHET Normal

Detaljer

Anemier ved erytrocytt-enzymdefekter og hemoglobinopatier. Petter Urdal Avd for medisinsk biokjemi Oslo Universitetssykehus, Ullevål

Anemier ved erytrocytt-enzymdefekter og hemoglobinopatier. Petter Urdal Avd for medisinsk biokjemi Oslo Universitetssykehus, Ullevål Anemier ved erytrocytt-enzymdefekter og hemoglobinopatier Petter Urdal Avd for medisinsk biokjemi Oslo Universitetssykehus, Ullevål Arvelige erytrocyttdefekter Enzymer Glukose-6-fosfat dehydrogenase, pyruvat

Detaljer

UNIVERSITETET I AGDER

UNIVERSITETET I AGDER FAKULTET FOR TEKNOLOGI OG REALFAG EKSAMEN Emnekode: BI0105 Emnenavn: Genetikk og evolusjon Dato: 21. november 2011 Varighet: 2 timer Antall sider inkl. forside 8 Tillatte hjelpemidler: Kalkulator Merknader:

Detaljer

Biobanker for Helse BioHealth. Camilla Stoltenberg FUGE Sluttrapporteringseminar Oslo 21. mai 2008

Biobanker for Helse BioHealth. Camilla Stoltenberg FUGE Sluttrapporteringseminar Oslo 21. mai 2008 Biobanker for Helse BioHealth Camilla Stoltenberg FUGE Sluttrapporteringseminar Oslo 21. mai 2008 Hva er budskapet? Det er verdt å satse på biobankene og helseundersøkelsene Vi vil finne årsaker til utbredte

Detaljer

Fosterdiagnostikk for Huntington. Øivind Braaten, Avdeling for medisinsk genetikk, Oslo universitetssykehus

Fosterdiagnostikk for Huntington. Øivind Braaten, Avdeling for medisinsk genetikk, Oslo universitetssykehus Fosterdiagnostikk for Huntington Øivind Braaten, Avdeling for medisinsk genetikk, Oslo universitetssykehus Undersøkelse i svangerskapet Tre muligheter: Morkakeprøve Sette inn egg som er undersøkt på forhånd

Detaljer

Vurdering av dagen praksis for abort etter 22. svangerskapsuke

Vurdering av dagen praksis for abort etter 22. svangerskapsuke v2.2-18.03.2013 Helse- og omsorgsdepartementet Postboks 8011 Dep 0030 OSLO Deres ref.: Vår ref.: 14/6378-8 Saksbehandler: Cecilie Sommerstad Dato: 29.10.2014 Vurdering av dagen praksis for abort etter

Detaljer

Obligatorisk innlevering 3kb vår 2004

Obligatorisk innlevering 3kb vår 2004 Obligatorisk innlevering 3kb vår 2004 1 I marsvin er mørk pels farge (F) dominant over albino (f), og hår (K) dominant over langt hår (k). Genene for disse to egenskapene følger prinsippet om uavhengig

Detaljer

Innføringskurs om autisme

Innføringskurs om autisme 1 Innføringskurs om autisme Diagnostisering og utredning av autisme 2 Utredning av barn med utviklingsforstyrrelser Grundig anamnesne Medisinsk/somatisk undersøkelser Observasjon i barnehage/skole/hjemme

Detaljer

GRUNNLEGGENDE GENETISKE BEGREPER Del I - en serie om kattegenetikk

GRUNNLEGGENDE GENETISKE BEGREPER Del I - en serie om kattegenetikk GRUNNLEGGENDE GENETISKE BEGREPER Del I - en serie om kattegenetikk Dette er første del i en serie om kattegenetikk. I denne første delen vil jeg ta for meg de ulike genetiske begrepene som blir brukt i

Detaljer

Kapittel 10, del 2: Klassisk genetikk: Mendels arvelover. -forhold som influerer fenotypen slik at den avviker fra det Mendel observerte:

Kapittel 10, del 2: Klassisk genetikk: Mendels arvelover. -forhold som influerer fenotypen slik at den avviker fra det Mendel observerte: Kapittel 10, del 2: Klassisk genetikk: Mendels arvelover -forhold som influerer fenotypen slik at den avviker fra det Mendel observerte: 1. Dominansforhold 2. Multiple allel 3. Geninteraksjon 4. Genuttrykk

Detaljer

I lys av akkreditering Overgang fra Sanger sekvensering til dypsekvensering innen genetisk sykdomsdiagnostikk

I lys av akkreditering Overgang fra Sanger sekvensering til dypsekvensering innen genetisk sykdomsdiagnostikk I lys av akkreditering Overgang fra Sanger sekvensering til dypsekvensering innen genetisk sykdomsdiagnostikk Knut Erik Berge, Avdeling for medisinsk genetikk, Oslo universitetssykehus Ullevål Agenda DNA

Detaljer

Juvenil Spondylartritt/Entesitt Relatert Artritt (SpA-ERA)

Juvenil Spondylartritt/Entesitt Relatert Artritt (SpA-ERA) www.printo.it/pediatric-rheumatology/no/intro Juvenil Spondylartritt/Entesitt Relatert Artritt (SpA-ERA) Versjon av 2016 1. HVA ER JUVENIL SPONDYLARTRITT/ENTESITT RELATERT ARTRITT (SpA-ERA) 1.1 Hva er

Detaljer

www.printo.it/pediatric-rheumatology/no/intro

www.printo.it/pediatric-rheumatology/no/intro www.printo.it/pediatric-rheumatology/no/intro Majeed Versjon av 2016 1. HVA ER MAJEED SYNDROM? 1.1 Hva er det? Majeed syndrom er en sjelden genetisk sykdom. Pasientene har kronisk tilbakevendende multifokal

Detaljer

Karin Bruzelius. Vedr. genetisk testing av pasienter med 22q11 indikasjon

Karin Bruzelius. Vedr. genetisk testing av pasienter med 22q11 indikasjon v2.1-04.02.2013 Karin Bruzelius Deres ref.: Vår ref.: 12/8853-3 Saksbehandler: Ola Johnsborg Dato: 23.01.2013 Vedr. genetisk testing av pasienter med 22q11 indikasjon Vi viser til mottatt korrespondanse

Detaljer

Genetisk testing. Genetisk testing. Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer

Genetisk testing. Genetisk testing. Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer NTNU Genetisk testing 1 Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer 2 Genetisk testing Formålet med genetisk testing er: finne den genetiske årsaken til tilstanden

Detaljer

R.Melsom,april 2012 1

R.Melsom,april 2012 1 Samarbeid mellom : TOP, Ole A Andreassen,Institutt for psykiatri OUS Barnehabiliteringsseksjonen, Mor-barn klinikken OUS Barnepsykiatrisk avd, Psykiatrisk Klinikk, OUS BUP, Bærum Sykehus,Vestre Viken psyk.klinikk

Detaljer

Født Født sånn sånn eller blitt sånn? Monica Cheng Munthe-Kaas, OUS 11.09.2013

Født Født sånn sånn eller blitt sånn? Monica Cheng Munthe-Kaas, OUS 11.09.2013 Født Født sånn sånn eller blitt blitt sånn? sånn? Monica Cheng Munthe-Kaas, OUS 11.09.2013 Innlandskongressen for Helseforskning 11 September 2013 Monica Cheng Munthe-Kaas Gener versus Miljø HJERNEVASK

Detaljer

BIO 1000 LAB-ØVELSE 1

BIO 1000 LAB-ØVELSE 1 Navn: Parti: Journalen leveres senest tirsdag 13. September 2005 i kassen utenfor labben. BIO 1000 LAB-ØVELSE 1 MENDELSK GENETIKK 6. september 2005 Faglig ansvarlig: Hovedansvarlig for lab-øvelsen: Øystein

Detaljer

Helsegevinst ultralyd uke 12

Helsegevinst ultralyd uke 12 Helsegevinst ultralyd uke 12 Tvillinger Medfødte hjertefeil Alvorlige utviklingsavvik Preeklampsi Kromosomfeil Nasjonalt råds møte 11.04.11 Kjell Å. Salvesen Tvillinger Flerlinger i Norge - 2011 Antall

Detaljer

NTNU. Genetisk testing. Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer

NTNU. Genetisk testing. Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer NTNU Genetisk testing 1 Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer Aktuelle læringsmål: (5.1.2 beskrive de viktigste metodene innen moderne molekylærbiologi, og

Detaljer

Innhold. Del 1 - Utviklingshemning

Innhold. Del 1 - Utviklingshemning 7 Innhold Del 1 - Utviklingshemning Kapittel 1 Frode Kibsgaard Larsen og Elisabeth Wigaard En god aldringsprosess... 16 Modeller for god aldring... 17 Tiltak for å oppnå god aldring... 18 Bokens oppbygging...

Detaljer

Laboratorium for medisinsk biokjemi og blodbank. www.helse-forde.no/lmbb

Laboratorium for medisinsk biokjemi og blodbank. www.helse-forde.no/lmbb Laboratorium for medisinsk biokjemi og blodbank. www.helse-forde.no/lmbb LAB- nytt nr 1-2008 INNHALD: Endring av metode for analyse av s-folat Gentest ved utredning av laktoseintoleranse Vurdering av glomerulær

Detaljer

6 forord. Oslo, oktober 2013 Stein Andersson, Tormod Fladby og Leif Gjerstad

6 forord. Oslo, oktober 2013 Stein Andersson, Tormod Fladby og Leif Gjerstad [start forord] Forord Demens er en av de store utfordringene i moderne medisin. Vi vet at antallet mennesker som vil bli rammet av sykdommer som gir demens, antakelig vil dobles de neste to tiårene, og

Detaljer

Persontilpasset medisin og sjeldne diagnoser

Persontilpasset medisin og sjeldne diagnoser Man skal ikke skjære alle over én kam Persontilpasset medisin og sjeldne diagnoser Benedicte Paus vdeling for medisinsk genetikk, Oslo universitetssykehus Institutt for klinisk medisin, Universitetet i

Detaljer

Autismespektervansker

Autismespektervansker Helse Midt 24.10.11 Genetiske syndromer og autismespektervansker Autismespektervansker Britta Nilsson Psykolog/Sekjsonsleder Oslo universitetssykehus Tre barn med autismespekterforstyrrelse Daniel barneautisme.

Detaljer

Høringsnotat. Forskrift om farmakogenetiske undersøkelser

Høringsnotat. Forskrift om farmakogenetiske undersøkelser Høringsnotat Helse- og omsorgsdepartementet Forskrift om farmakogenetiske undersøkelser Side 1 av 7 1 Hovedinnhold Helse- og omsorgsdepartementet foreslår i dette høringsnotatet en ny forskrift som skal

Detaljer

02.05.2011. Kasuistikk. Risiko for blodpropp. Koagulasjon - oversikt. Trombedannelse. Arvelig Trombofili

02.05.2011. Kasuistikk. Risiko for blodpropp. Koagulasjon - oversikt. Trombedannelse. Arvelig Trombofili Kasuistikk 17 år gammel pike ønsker p-piller Risiko for blodpropp Arvelig trombofili Normal anamnese indikasjon for trombofiliutredning? Ingen VTE hos din, men VTE hos mor/far/søsken: Trombofiliutredning?

Detaljer

Rett eller slett medikamentell behandling

Rett eller slett medikamentell behandling Ikke enkelt når det er dobbelt. Om psykiske lidelser hos utviklingshemmede. Konferanse i Bergen 3. og 4. mai 2012 Rett eller slett medikamentell behandling Overlege Ivar Mæhle Tekst: Sølvi Linde Foto:

Detaljer

Genetikk og nyfødtscreening. Trine Prescott Avdeling for medisinsk genetikk, OUS September 2011

Genetikk og nyfødtscreening. Trine Prescott Avdeling for medisinsk genetikk, OUS September 2011 Genetikk og nyfødtscreening Trine Prescott Avdeling for medisinsk genetikk, OUS September 2011 Far 1 gen Genfeil = Autosomal recessiv arv kromosompar Mor Kjønnsceller Barn Syk 25% Frisk bærer Frisk bærer

Detaljer

Trisomi 13 og 18! for Større Barn!

Trisomi 13 og 18! for Større Barn! 13 18 Trisomi 13 og 18 for Større Barn For foreldre Side 2 Kromosomer Side 3 Trisomi 13 og 18 Side 4 Før babyen er født Side 5 En baby med trisomi Side 6 Hjemme med babyen Side 7 Et barn med trisomi Side

Detaljer

Mal for vurderingsbidrag

Mal for vurderingsbidrag Mal for vurderingsbidrag Fag: Naturfag Tema: Tar for seg følgende i lærerplanen. Beskrive oppbygningen av dyreceller. Gjøre greie for celledeling samt genetisk variasjon og arv. Temaet brukes ofte som

Detaljer

Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling?

Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling? Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling? Hege G. Russnes Forsker ved Avd. For Genetikk, Institutt for Kreftforskning og overlege ved Avd. For Patologi Oslo Universitetssykehus

Detaljer

Helse, fysisk aktivitet og ernæring hva sier forskningen?

Helse, fysisk aktivitet og ernæring hva sier forskningen? Helse, fysisk aktivitet og ernæring hva sier forskningen? Marianne Nordstrøm Klinisk ernæringsfysiolog, PhD Frambu kompetansesenter for sjeldne diagnoser Utviklingshemning Forsinket og ufullstendig utvikling

Detaljer

Nasjonal faglig retningslinje for utredning og oppfølging av hørsel hos nyfødte.

Nasjonal faglig retningslinje for utredning og oppfølging av hørsel hos nyfødte. Helsedirektoratet Avdeling rehabilitering og sjeldne tilstander Postboks 7000 St. Olavs plass, 0130 Oslo Vår saksbehandler: Vår ref.: Marit Stene Severinsen 827665 (2016_00215) Vår dato: 13.4.2016 Høringssvar:

Detaljer

Født sånn OG blitt sånn: gener og miljø i barns utvikling

Født sånn OG blitt sånn: gener og miljø i barns utvikling Født sånn OG blitt sånn: gener og miljø i barns utvikling TTiT Tidlig Trygg i Trondheim Barn født i 2003/2004 Foreldre, lærere 1000 barn Identifiserer risiko og beskyttelsesfaktorer for utvikling av psykisk

Detaljer

Mendelsk Genetikk (kollokvium 01.09.2005)

Mendelsk Genetikk (kollokvium 01.09.2005) Mendelsk Genetikk (kollokvium 01.09.2005) 1) Hos marsvin er allelet som koder for svart pels (B) dominant i forhold allelet som gir hvit pels (b). Halvparten av avkommet i et kull var hvite. Hvilke genotyper

Detaljer

DEMENS FOR FOLK FLEST. Audhild Egeland Torp Overlege medisinsk avdeling, Sørlandet sykehus Arendal

DEMENS FOR FOLK FLEST. Audhild Egeland Torp Overlege medisinsk avdeling, Sørlandet sykehus Arendal DEMENS FOR FOLK FLEST Audhild Egeland Torp Overlege medisinsk avdeling, Sørlandet sykehus Arendal Demens Sykdom eller skade i hjernen Tap eller redusert funksjon av hjerneceller I en del av hjernen eller

Detaljer

Manglende tenner og litt til

Manglende tenner og litt til Manglende tenner og litt til Hilde Nordgarden TAKO-senteret Avdeling for pedodonti og atferdsfag, UiO NFP-seminar Molde 10.11.05 Disposisjon Organutvikling Definisjoner Prevalens Agenesimønster Assosierte

Detaljer

Politiets fokus på utviklingshemmede i straffesaker.

Politiets fokus på utviklingshemmede i straffesaker. Politiets fokus på utviklingshemmede i straffesaker. NFSS Årskonferanse Alta- 2016 Politioverbetjent Rolf Arne Sætre, seksjon for seksuallovbrudd, Taktisk etterforskningsavdeling, KRIPOS Rolleavklaring,

Detaljer

Genetikk og persontilpasset medisin Ny teknologi nye muligheter og nye utfordringer

Genetikk og persontilpasset medisin Ny teknologi nye muligheter og nye utfordringer Genetikk og persontilpasset medisin Ny teknologi nye muligheter og nye utfordringer Dag Undlien Avdeling for medisinsk genetikk Oslo Universitetssykehus d.e.undlien@medisin.uio.no Dep of Medical Genetics

Detaljer

Elevundersøkelsen Bergen kommune, vår 09: Et nærmere blikk på mobbing, uro, motivasjon, bruk av PC

Elevundersøkelsen Bergen kommune, vår 09: Et nærmere blikk på mobbing, uro, motivasjon, bruk av PC Elevundersøkelsen Bergen kommune, vår 09: Et nærmere blikk på mobbing, uro, motivasjon, bruk av PC Dette notatet er en sammenstilling av et utvalg av spørsmålene i Elevundersøkelsen. Mobbing Spørsmål:

Detaljer

BIO 1000 LAB-ØVELSE 2. Populasjonsgenetikk 20. september 2005

BIO 1000 LAB-ØVELSE 2. Populasjonsgenetikk 20. september 2005 Navn: Parti: Journalen leveres senest tirsdag 27. September 2005 i kassen utenfor labben. BIO 1000 LAB-ØVELSE 2 Populasjonsgenetikk 20. september 2005 Faglig ansvarlig: Eli K. Rueness Hovedansvarlig for

Detaljer

Molekylær karyotypering ved prenatal diagnostikk

Molekylær karyotypering ved prenatal diagnostikk Molekylær karyotypering ved prenatal diagnostikk 5. års oppgave i Stadium IV - medisinstudiet ved Universitetet i Tromsø Tonje Kræmer TROMSØ SEPTEMBER 2010 Veiledere: Valeria Marton, overlege, dr. med

Detaljer

Tidlig ultralyd. Gro Jamtvedt, avdelingsdirektør, Nasjonalt kunnskapssenter for helsetjenesten

Tidlig ultralyd. Gro Jamtvedt, avdelingsdirektør, Nasjonalt kunnskapssenter for helsetjenesten Nasjonalt råd for kvalitet og prioritering i helse- og omsorgstjenesten, 5. desember 2011 Tidlig ultralyd Kunnskapsesenterets nye PPT-mal Gro Jamtvedt, avdelingsdirektør, Nasjonalt kunnskapssenter for

Detaljer

Forslag til nasjonal metodevurdering

Forslag til nasjonal metodevurdering Forslagsskjema, Versjon 2 17. mars 2014 Forslag til nasjonal metodevurdering Innsendte forslag til nasjonale metodevurderinger vil bli publisert i sin helhet. Dersom forslagsstiller mener det er nødvendig

Detaljer

Innføringskurs om autisme

Innføringskurs om autisme 1 Innføringskurs om autisme Hva er autisme 2 Diagnostiske kriterier for gjennomgripende utviklingsforstyrrelser En gruppe lidelser karakterisert ved kvalitative forstyrrelser i sosialt samspill og kommunikasjonsmønstre

Detaljer

Naturfag for ungdomstrinnet

Naturfag for ungdomstrinnet Naturfag for ungdomstrinnet Arv Illustrasjoner: Ingrid Brennhagen 1 Vi skal lære om arvestoffet, DNA celledeling genetisk variasjon arv 2 DNA Arvestoffet kalles DNA. DNA er kjempestore molekyler som inneholder

Detaljer

Barneleddgikt (Juvenil Idiopatisk Artritt- JIA)

Barneleddgikt (Juvenil Idiopatisk Artritt- JIA) www.printo.it/pediatric-rheumatology/no/intro Barneleddgikt (Juvenil Idiopatisk Artritt- JIA) Versjon av 2016 2. FORSKJELLIGE TYPER BARNELEDDGIKT 2.1 Hvilke typer finnes? Det er flere former for barneleddgikt.

Detaljer

Stortingsmeldingens betydning for fagfeltet. Sett fra spesialisthelsetjenesten. Nils Olav Aanonsen. Avd for nevrohabilitering, OUS Oslo, 21.10.

Stortingsmeldingens betydning for fagfeltet. Sett fra spesialisthelsetjenesten. Nils Olav Aanonsen. Avd for nevrohabilitering, OUS Oslo, 21.10. Stortingsmeldingens betydning for fagfeltet. Sett fra spesialisthelsetjenesten Avd for nevrohabilitering, OUS Oslo, 21.10.13 Medisinske spesialiteter ca 44 DNLF Hjerte, lunge, ortopedi, hjernekirurgi osv..

Detaljer

Genkartlegging. Hva er egentlig et genkart? Genetisk og fysisk kartlegging

Genkartlegging. Hva er egentlig et genkart? Genetisk og fysisk kartlegging NTNU Genkartlegging 1 Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer Hva er egentlig et genkart? Kartet over det humane genom gir oss posisjonen av de ca 25,000 genene

Detaljer

Spesialisthelsetjenesten: Behandling av pasienter med sjeldne sykdommer

Spesialisthelsetjenesten: Behandling av pasienter med sjeldne sykdommer Spesialisthelsetjenesten: Behandling av pasienter med sjeldne sykdommer Terje Rootwelt Oslo universitetssykehus Sjelden sykdom - hvorfor viktig nå? Revolusjon innen genetikk og biokjemi - molekylærbiologi:

Detaljer

Fagfeltet de neste 20 år. Nils Olav Aanonsen Avdelingsleder Avd. for nevrohabilitering Oslo universitetssykehus

Fagfeltet de neste 20 år. Nils Olav Aanonsen Avdelingsleder Avd. for nevrohabilitering Oslo universitetssykehus Fagfeltet de neste 20 år Nils Olav Aanonsen Avdelingsleder Avd. for nevrohabilitering Oslo universitetssykehus Ansvarsreformen 1991-96 HVPU- reformen Samhandlingsreformen 2012-2016 Rett behandling- på

Detaljer

1 FRA BESTEFAR TIL BARNEBARN: En persons traumatiske opplevelser kan bli overført til de neste generasjonene, viser undersøkelsen.

1 FRA BESTEFAR TIL BARNEBARN: En persons traumatiske opplevelser kan bli overført til de neste generasjonene, viser undersøkelsen. 1 FRA BESTEFAR TIL BARNEBARN: En persons traumatiske opplevelser kan bli overført til de neste generasjonene, viser undersøkelsen. Minner kan gå i arv Dine barn kan arve din frykt og redsel, enten du vil

Detaljer

Hvorfor er det viktig med høy vaksinasjonsdekning, og hvordan oppnå det? Hanne Nøkleby Folkehelseinstituttet Agderkonferansen 2016

Hvorfor er det viktig med høy vaksinasjonsdekning, og hvordan oppnå det? Hanne Nøkleby Folkehelseinstituttet Agderkonferansen 2016 Hvorfor er det viktig med høy vaksinasjonsdekning, og hvordan oppnå det? Hanne Nøkleby Folkehelseinstituttet Agderkonferansen 2016 Hvorfor fokus på vaksinasjonsprogrammet? All vaksinasjon tar sikte på

Detaljer

Obstipasjon Encoprese. Overlege Unni Mette Stamnes Köpp Barneavdelingen Sørlandet sykehus Kristiansand

Obstipasjon Encoprese. Overlege Unni Mette Stamnes Köpp Barneavdelingen Sørlandet sykehus Kristiansand Obstipasjon Encoprese Overlege Unni Mette Stamnes Köpp Barneavdelingen Sørlandet sykehus Kristiansand Definisjon Kronisk intestinal pseudoobstipasjon Skiller seg fra en heterogen gruppe sjeldne GI nevrogene

Detaljer

Cryopyrin Assosiert Periodisk Syndrom (CAPS)

Cryopyrin Assosiert Periodisk Syndrom (CAPS) www.printo.it/pediatric-rheumatology/no/intro Cryopyrin Assosiert Periodisk Syndrom (CAPS) Versjon av 2016 1. HVA ER CAPS? 1.1 Hva er det? CAPS er en felles betegnelse for en gruppe autoimmune sykdommer

Detaljer

Litt om utredning og genetikk fra en klinikers ståsted. Bergen MIUH 011112 Nils Olav Aanonsen Avd for nevrohabilitering, OUS

Litt om utredning og genetikk fra en klinikers ståsted. Bergen MIUH 011112 Nils Olav Aanonsen Avd for nevrohabilitering, OUS Litt om utredning og genetikk fra en klinikers ståsted Bergen MIUH 011112 Nils Olav Aanonsen Avd for nevrohabilitering, OUS Gj.snitt 2008-2011 Utredning PU autisme CP muskel Epilepsi annet 2008-2011 42%

Detaljer

Matematisk evolusjonær genetikk (ST2301)

Matematisk evolusjonær genetikk (ST2301) Norges teknisk naturvitenskapelige universitet Institutt for matematiske fag Side 1 av 9 Matematisk evolusjonær genetikk (ST2301) Tirsdag 19. mai 2009 Løsningsforslag (For flere av oppgavene finnes det

Detaljer

Hva er Williams syndrom?

Hva er Williams syndrom? Hva er Williams syndrom? Fagkurs Frambu 6. juni 2017 Anne Grethe Myhre Lege, Frambu agm@frambu.no Williams syndrom En sjelden, medfødt og varig tilstand Skyldes en forandring i arvematerialet Oppkalt etter

Detaljer

Periodisk Feber med Aftøs Faryngitt og Adenitt (PFAPA)

Periodisk Feber med Aftøs Faryngitt og Adenitt (PFAPA) www.printo.it/pediatric-rheumatology/no/intro Periodisk Feber med Aftøs Faryngitt og Adenitt (PFAPA) Versjon av 2016 1. HVA ER PFAPA 1.1 Hva er det? PFAPA står for Periodic Fever Adenitis Pharyngitis Aphthosis.

Detaljer

» Etiske grunnregler for avl og oppdrett» Avlsstrategi

» Etiske grunnregler for avl og oppdrett» Avlsstrategi » Etiske grunnregler for avl og oppdrett» Avlsstrategi www.nkk.no Foto: Vibeke Brath Juni 2015 EXTRAORDINÆR ERNÆRING TIL EKSTRAORDINÆRE HUNDER Som medlem i Eukanuba Breeders Club får du mange fordeler

Detaljer

Eksomsekvensering og MODY Nålen i høystakken eller nyttig diagnostisk verktøy?

Eksomsekvensering og MODY Nålen i høystakken eller nyttig diagnostisk verktøy? Eksomsekvensering og MODY Nålen i høystakken eller nyttig diagnostisk verktøy? Lege og stipendiat Henrik Irgens KG Jebsen Senter for diabetesforskning HUS/UIB MODY Klassiske kliniske kriterier: Dominant

Detaljer

Kjerubisme. Kjerubisme er en sjelden, arvelig diagnose som rammer underkjeven, i alvorlige tilfeller også overkjeven.

Kjerubisme. Kjerubisme er en sjelden, arvelig diagnose som rammer underkjeven, i alvorlige tilfeller også overkjeven. Kjerubisme Kjerubisme er en sjelden, arvelig diagnose som rammer underkjeven, i alvorlige tilfeller også overkjeven. SENTER FOR SJELDNE DIAGNOSER www.sjeldnediagnoser.no KJERUBISME Kjerubisme er en meget

Detaljer

Høring om idéfase Sjukehuset i Nordmøre og Romsdal, SNR

Høring om idéfase Sjukehuset i Nordmøre og Romsdal, SNR Klinikk for psykisk helsevern Seksjon for voksenhabilitering Nordmøre og Romsdal Helse Møre og Romsdal HF 6026 Ålesund Dykkar ref: Vår ref: kto Dato: 03.10.2014 Høring om idéfase Sjukehuset i Nordmøre

Detaljer

10/8/2013. video1. Progressive axonopathy (PA) Diagnostiske tester. Patellar refleks. Plasserings refleks

10/8/2013. video1. Progressive axonopathy (PA) Diagnostiske tester. Patellar refleks. Plasserings refleks Progressive axonopathy (PA) en sykdom i nervesystemet som begrensen hundens evne til å kontrollere bevegelsene sine Patellar refleks Diagnostiske tester Plasserings refleks erve konduktivitet (evne til

Detaljer

Møtesaksnummer 20/17. Saksnummer 16/ Dato 14. mars Kontaktperson Tove Ringerike

Møtesaksnummer 20/17. Saksnummer 16/ Dato 14. mars Kontaktperson Tove Ringerike Møtesaksnummer 20/17 Saksnummer 16/12244 Dato 14. mars 2017 Kontaktperson Tove Ringerike Sak Gentesting ved alvorlig sykdom Hovedproblemstillinger Vignetten listet de mest sentrale problemstillingene som:

Detaljer

Tumor Nekrose Faktor Reseptor Assosiert Periodisk Syndrom (TRAPS) eller Familiær Hiberniansk Feber

Tumor Nekrose Faktor Reseptor Assosiert Periodisk Syndrom (TRAPS) eller Familiær Hiberniansk Feber www.printo.it/pediatric-rheumatology/no/intro Tumor Nekrose Faktor Reseptor Assosiert Periodisk Syndrom (TRAPS) eller Familiær Hiberniansk Feber Versjon av 2016 1. HVA ER TRAPS 1.1 Hva er det? TRAPS er

Detaljer

Gensaksen CRISPR - Når ivlet. Sigrid B. Thoresen, Seniorrådgiver i Bioteknologirådet

Gensaksen CRISPR - Når ivlet. Sigrid B. Thoresen, Seniorrådgiver i Bioteknologirådet Gensaksen CRISPR - Når ivlet kan l i v e t redigeres Sigrid B. Thoresen, Seniorrådgiver i Bioteknologirådet Genterapi /Genmodifisering Editing humanity The life editor The age of the red pen CRISPR, the

Detaljer

Ny ILAE klassifikasjon av epilepsiene

Ny ILAE klassifikasjon av epilepsiene Ny ILAE klassifikasjon av epilepsiene Norsk oversettelse Oliver Henning og Karl Otto Nakken ILAE = International League Against Epilepsy Klassifikasjonen ILAE commision for classification and terminology

Detaljer

www.printo.it/pediatric-rheumatology/no/intro

www.printo.it/pediatric-rheumatology/no/intro www.printo.it/pediatric-rheumatology/no/intro Lyme Artritt Versjon av 2016 1. HVA ER LYME ARTRITT? 1.1 Hva er det? Lyme artritt er en av sykdommene som skyldes bakterien Borrelia burgdorferi (Lyme borreliose).

Detaljer

Genetikk og psykiatriske lidelser Hvilke sammenhenger ser man?

Genetikk og psykiatriske lidelser Hvilke sammenhenger ser man? Genetikk og psykiatriske lidelser Hvilke sammenhenger ser man? Ted Reichborn-Kjennerud, dr. med. Avdeling for psykisk helse Nasjonalt Folkehelseinstitutt Arv og miljø Genetiske ulikheter har lenge vært

Detaljer