Genetisk variasjon i naturlige populasjoner. grunnlag for foredling. Mari Mette Tollefsrud. Foto: Arne Steffensrem

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Begynne med side:

Download "Genetisk variasjon i naturlige populasjoner. grunnlag for foredling. Mari Mette Tollefsrud. Foto: Arne Steffensrem"

Transkript

1 Genetisk variasjon i naturlige populasjoner grunnlag for foredling Mari Mette Tollefsrud Foto: Arne Steffensrem

2 Genetisk variasjon Summen av forskjeller i genotypene til individene i en populasjon Oppstår gjennom mutasjoner, endringer i kromosomene, rekombinasjon, migrasjon, overføring fra andre arter Forutsetningen for seleksjon og genetisk drift Eksempel på fenotypisk variasjon hos søsken fra to forskjellige fullsøsken familer

3 Genetisk variasjon Mesteparten av den molekylærgenetiske variasjonen er fenotypisk nøytral Et gen er et område av DNA som koder for et RNA molekyl De fleste RNA molekylene koder igjen for proteiner Genetisk variasjon kommer til uttrykk når det kodede proteinet får forskjellige aminosyrer, eller når genet reguleres forskjellig. Illustrasjonene er hentet fra:

4 Eksempler på variasjon i DNA molekylet ATTATGACACACACACACA GGATTAATGG ATTATGACACACACACACACACAGGATTAATGG

5 Gran stor genetisk variasjon Store sammenhengende populasjoner Stor pollen og frø produksjon med transport over store avstander Utkrysning Viktig egenskap som viser svært stor genetisk variasjon mellom trær av ulike provenienser, er tilpasning til klima Foto: Terje Birkeland, 2006

6 Variasjon i frostherdighet på høsten Testet provenienser i felles miljø Skader av frost (%) Høyde over havet (meter) Breddegrad ( N) Klinal variasjon: herdigheten øker fra syd mot nord, fra lavlandet til fjellet Proveniensene reagerer ulikt på daglengde og temperatur

7 Variasjon mellom og innen provenienser Frostskader (normal scores) 0,6 0,4 0,2 0,0-0,2-0,4-0,6 Frostskader (normal scores) 0,6 0,4 0,2 0,0-0,2-0,4-0,6 65 N Breddegrad ( N) Familier innen bestand Innen bestandsvariasjon tilsvarer fire breddegrader i proveniensvariasjon!

8 Molekylærgenetisk struktur hos gran Variasjon i mitokondrie DNA nedarvet fra mor til datter spredt med frø I Nord-Europa fant vi 14 forskjellige genetiske varianter 27 % av variasjonen i Nord-Europa skyldes forskjeller mellom populasjonene Et refugium i Russland To spredningsveier

9 Molekylærgenetisk struktur hos gran 83% av variasjonen forklares av forskjellene mellom Nord-Europa og Sør- og Mellom-Europa

10 Molekylærgenetisk struktur hos gran Hva har vi funnet ut? Refugie områder Spredningsveier Utviklingen av diversiteten langs spredningsveiene Hvordan er diversiteten fordelt? Diversiteten øker med alderen på populasjonene (unntak i de vestre Karpatene) Diversiteten opprettholdt over store avstander i det nordlige utbredelsesområdet

11 Molekylærgenetisk struktur hos gran fortsetter. nå målt med en annen metode som også inkluderer pollenflyt Høy genetisk variasjon, hvert nøytralt gen gj.sn. 22 forskjellige alleler 96.84% av variasjonen skyldes variasjon innen populasjonene 1.77% av variasjonen skyldes forskjeller mellom populasjonene innen gruppene 1.44% av variasjonen skyldes forskjeller mellom de genetiske gruppene

12 Pollen flyt sammenlignet med frøflyt fra øst til vest Heterozygositet Høyt nivå av pollen flyt fra øst mot vest, spesielt i sør sammenlignet med historisk frøflyt

13 Pollen flyt sammenlignet med frøflyt fra sør til nord Heterozygositet Lavt nivå av pollen flyt i nord sammenlignet med høy historisk frøflyt

14 Innavl i gran? Alle populasjoner viste avvik fra Hardy- Weinberg likevekt Innavls koeffisienten økte signifikant nordover, r= Mindre pollen produksjon i nord kan forklare den økte innavlen nordover

15 Innavl i furu Rommelig genetisk struktur og innavl i en skjøttet populasjon av furu i Sverige naturlig foryngelse (Garcia-Gil et al. 2009) Innavlskoeffisient på 0.25 tilsvarer en blanding av halvsøsken og fullsøsken, sannsynligvis har bestandet blitt etablert fra allerede beslektede frøtrær Foto: Taipo Hurme Disse resultatene er i sterk kontrast til teorien om at innavlsdepresjoner siler ut innavla individer på et tidlig stadium

16 Innavl Forholdet mellom innavlskoeffisienten og relativt stamme volum hos gran Figurene er hentet fra An introduction to forest genetics, Eriksson med flere 2007.

17 Foredling og genetisk diversitet Vil en utvelgelse av trær med ønskede egenskaper forringe mengden av genetisk diversitet? Det vi ønsker er å forme uniforme populasjoner hver til sitt optimale område! Heterozygostieten forringes langsommere enn tap av allelisk rikhet når man gjør et utvalg, spesielt de sjeldne allelene som blir borte. Er sjeldne alleler viktig? Når det gjelder genene som styrer de adaptive egenskapene, vet vi ikke hvor mange alleler som er tilstede! Så langt har vi stor sett kunnskap fra de nøytrale områdene i DNA molelekylet..

18 Genetisk variasjon i foredlingspopulasjoner, frøplantasjer og naturlige populasjoner British Colombia Douglas gran Denne studien viser at man ved et riktig utvalg fanger artens genetiske variasjon, og faktisk samler den ved å inkludere populasjoner fra forskjellige steder! Differensieringen mellom populasjoner viktig bidrag til total variasjonen!

19 Genetiske strukturer i frøplantasjer av gran Tysk studie som viser at det ikke er noe forskjell i diversitet (polymorfe loci, antall alleler) mellom en frøplantasje i Bayern og de omkringliggende naturlige populasjoner Fant høyere grad av heterozygositet i frøplantasjene (Bergman og Ruetz 1991) Pollenflyt utenfra er en viktig faktor som tynner ut den genetiske gevinsten av foredlingen Polsk studie som viser at så mye som 83% av fedrene kommer utenfra frøplantasjen. (Burczyk et al. 2004) Effektiv populasjonsstørrelse på pollengiverne innenfor frøplantasjen var bare 6.7 av i alt 90 potensielle!! Og disse bestøvet bare de aller nærmeste hunnene (Burczyk et al. 2004) Problemfrøplantasje??

20 Råmaterialet til foredlingen har vi! Molekylærgenetiske mønstre hos gran i Norge viser at nesten all variasjonen som er tilstede i de eldste områdene av gran i Russland har klart å komme seg til Norge, og det bare på år (?) Gran også stor genetisk variasjon i kvantitative karakterer, grunnlaget for utvalgsarbeidet Klinalvariasjon i både kvantitative og molekylærgenetiske karakterer Klinalvariasonen skyldes ikke bare seleksjon, men også historiske faktorer bidrar Liten differensiering i molekylærgenetiske egenskaper, variasjonen vil øke dramatisk hvis man inkluderer populasjoner fra mellom Europa i foredlingspopulasjonene Frøplantasjefrø gir bedre trær enn bestandsfrø, sannsynligvis p.g.a. oppheving av innavl

Kan vi ivareta genetisk variasjon samtidig som gevinsten øker

Kan vi ivareta genetisk variasjon samtidig som gevinsten øker Kan vi ivareta genetisk variasjon samtidig som gevinsten øker Jørn Henrik Sønstebø, Mari Mette Tollefsrud, Arne Steffenrem, Øyvind M. Edvardsen, Ragnar Johnskås, Anne E. Nilsen, Tor Myking, Yousry El Kassaby

Detaljer

Arv. ARV - Copyright 2015 Skogplanteforedling.no

Arv. ARV - Copyright 2015 Skogplanteforedling.no Arv Kapittel 1 - Genetisk variasjon side. 1 Genetisk variasjon - forutsetningen for seleksjon... side. 2 Gener i planteforedlingen side. 3 Genetisk variasjon i tilpasningsegenskaper side. 4 Genetisk variasjon

Detaljer

Genetikk i skogen. Jørn Henrik Sønstebø

Genetikk i skogen. Jørn Henrik Sønstebø Genetikk i skogen Jørn Henrik Sønstebø BAKGRUNN Genetisk variasjon basis for foredling Skogplanteforedling av gran Tradisjonell foredling Breeding without breeding Forvaltning av genetiske variasjonen

Detaljer

Gran og furu overlevde siste istid i Norge??? Mari Mette Tollefsrud, Norsk institutt for skog og landskap

Gran og furu overlevde siste istid i Norge??? Mari Mette Tollefsrud, Norsk institutt for skog og landskap Gran og furu overlevde siste istid i Norge??? Mari Mette Tollefsrud, Norsk institutt for skog og landskap Svendsen et al., 2004 Quat. Sci. Rev. Tidligere klimaendringer har dramatisk påvirket utbredelsen

Detaljer

Hvordan bevarer vi den genetiske variasjonen i foredlingen samtidig som vi henter ut størst mulig gevinst?

Hvordan bevarer vi den genetiske variasjonen i foredlingen samtidig som vi henter ut størst mulig gevinst? Hvordan bevarer vi den genetiske variasjonen i foredlingen samtidig som vi henter ut størst mulig gevinst? Hva er genetisk variasjon? Man kan se på genetisk variasjon på mange nivå Variasjon i egenskaper

Detaljer

«Rett plante på rett plasshva er best, lokalt eller tilflyttet?»

«Rett plante på rett plasshva er best, lokalt eller tilflyttet?» «Rett plante på rett plasshva er best, lokalt eller tilflyttet?» Kunnskapsgrunnlaget for anbefalinger av plantematerialer til norsk granskog Tore Skrøppa Seniorforsker Temaer Årlig vekstrytme fenologi

Detaljer

Foredlingsmetoden fra plusstreutvalg og avkomtesting til molekylær genetikk! Øystein Johnsen, Skog og landskap

Foredlingsmetoden fra plusstreutvalg og avkomtesting til molekylær genetikk! Øystein Johnsen, Skog og landskap Foredlingsmetoden fra plusstreutvalg og avkomtesting til molekylær genetikk! Øystein Johnsen, Skog og landskap St.meld. nr. 39; Klimautfordringene Regjeringen mener økt innsats i skogplanteforedlingen

Detaljer

Flytting av plantemateriale - gran

Flytting av plantemateriale - gran Flytting av plantemateriale - gran Tore Skrøppa Seniorforsker Temaer Årlig vekstrytme fenologi Genetisk variasjon Lokal tilpasning Hvorfor flytte plantematerialer? Lover og regler Tidligere erfaringer

Detaljer

Bærekraftig foredling

Bærekraftig foredling Øyvind Meland Edvardsen, Seniorrådgiver Skogfrøverket Arne Steffenrem, Forsker Skogfrøverket / NIBIO Bærekraftig foredling -anvendelse av forskningsresultatene Klimatilpasning Vår visjon Norsk skogplanteforedling

Detaljer

Bruk av foredlet frø - hva slags kunnskaper har vi? Tore Skrøppa Norsk institutt for skog og landskap NordGen Skog

Bruk av foredlet frø - hva slags kunnskaper har vi? Tore Skrøppa Norsk institutt for skog og landskap NordGen Skog Bruk av foredlet frø - hva slags kunnskaper har vi? Tore Skrøppa Norsk institutt for skog og landskap NordGen Skog Skogfrøverket er ansvarlig for, og utfører den praktiske foredlingen Skog og landskap

Detaljer

FoU prosjekt Elghund. 13.06.2015 Marte Wetten Geninova

FoU prosjekt Elghund. 13.06.2015 Marte Wetten Geninova FoU prosjekt Elghund 13.06.2015 Marte Wetten Geninova Hovedprosjekt Fra fenotype til genotype -utvikling av avlsprogram for de Norske Elghundrasene Hovedmål Overføre prinsipper fra avl på produksjonsdyr

Detaljer

Status foredling og frøforsyning: Hvor leveringsdyktige kan vi være på det beste plantematerialet? Hvor godt er det, og hvor bør vi bruke det?

Status foredling og frøforsyning: Hvor leveringsdyktige kan vi være på det beste plantematerialet? Hvor godt er det, og hvor bør vi bruke det? Status foredling og frøforsyning: Hvor leveringsdyktige kan vi være på det beste plantematerialet? Hvor godt er det, og hvor bør vi bruke det? Arne Steffenrem Norsk institutt for bioøkonomi / Skogfrøverket

Detaljer

Matematisk evolusjonær genetikk, ST2301 Onsdag 15. desember 2004 Løsningsforslag

Matematisk evolusjonær genetikk, ST2301 Onsdag 15. desember 2004 Løsningsforslag Norges teknisk-naturvitenskapelige universitet Institutt for matematiske fag Side av 5 Matematisk evolusjonær genetikk, ST30 Onsdag 5. desember 004 Løsningsforslag Oppgave a) Vi setter først navn på de

Detaljer

Foredling. FOREDLING - Copyright 2016 Skogplanteforedling.no

Foredling. FOREDLING - Copyright 2016 Skogplanteforedling.no Foredling Foredlingsstrategien side. 1 Foredlingsmål side. 2 Foredlingspopulasjoner side. 3 Foredlingspopulasjoner II side. 4 Nødvendig genetisk variasjon side. 5 Foredlingsgevinst side. 6 Tester side.

Detaljer

Hva kan vi forvente av skogplanteforedlingen? Arne Steffenrem Skogfrøverket / NIBIO Skog og tre, Gardermoen 1. juni 2017

Hva kan vi forvente av skogplanteforedlingen? Arne Steffenrem Skogfrøverket / NIBIO Skog og tre, Gardermoen 1. juni 2017 Hva kan vi forvente av skogplanteforedlingen? Arne Steffenrem Skogfrøverket / NIBIO Skog og tre, Gardermoen 1. juni 2017 LangsikCg frøforsyning fra frøplantasjer Prognose for hele landet 60 50 Planter

Detaljer

Prioriteringer og strategier for bærekraftig skogplanteforedling Vegårshei 14. juni Øyvind Meland Edvardsen Marte Friberg Myre & Arne

Prioriteringer og strategier for bærekraftig skogplanteforedling Vegårshei 14. juni Øyvind Meland Edvardsen Marte Friberg Myre & Arne Prioriteringer og strategier for bærekraftig skogplanteforedling Vegårshei 14. juni 2017 - Øyvind Meland Edvardsen Marte Friberg Myre & Arne Steffenrem Frøverksdrift Skogplanteforedling Kontrolloppgaver

Detaljer

Bør vi plante mer furu?

Bør vi plante mer furu? Bør vi plante mer furu? NordGen Skogs temadag: Foryngelse skogens fundament Comfort Hotel Runway, Gardermoen, 22. mars 2011 Torfinn Kringlebotn, Fylkesmannen i Hedmark Skog- og trestrategien Mål for Hedmark

Detaljer

Frøplantasjer. FRØPLANTASJER - Copyright 2015 Skogplanteforedling.no

Frøplantasjer. FRØPLANTASJER - Copyright 2015 Skogplanteforedling.no Frøplantasjer Introduksjon side. 1 De norske Skogfrøplantasjene side. 2 Bruksområder side. 3 Sanderud side. 4 Svenneby side. 5 Kaupanger side. 6 Jordtveitmonen side. 7 Kilen side. 8 e Bok: Frøplantasjene

Detaljer

Kontrollutvalget for frøforsyningen i skogbruket - hvem er vi og hva er vår oppgave?

Kontrollutvalget for frøforsyningen i skogbruket - hvem er vi og hva er vår oppgave? Kontrollutvalget for frøforsyningen i skogbruket - hvem er vi og hva er vår oppgave? Mari Mette Tollefsrud, leder og sekretær i Kontrollutvalget for frøforsyningen til skogbruket, forsker på Skog og landskap

Detaljer

Obligatorisk innlevering 3kb vår 2004

Obligatorisk innlevering 3kb vår 2004 Obligatorisk innlevering 3kb vår 2004 1 I marsvin er mørk pels farge (F) dominant over albino (f), og hår (K) dominant over langt hår (k). Genene for disse to egenskapene følger prinsippet om uavhengig

Detaljer

Løsningsforslag ST2301 Øving 11

Løsningsforslag ST2301 Øving 11 Løsningsforslag ST230 Øving Kapittel 6 Exercise I en diploid populasjon i Wright-Fisher-modellen, hvor mange generasjoner tar det før 90% av heterozygotene er tapt? Antar at det er N individer i populasjonen

Detaljer

Klar for 3. generasjons frøplantasjer! Foredlingssenter Midt-Norge

Klar for 3. generasjons frøplantasjer! Foredlingssenter Midt-Norge Klar for 3. generasjons frøplantasjer! Foredlingssenter Midt-Norge Arne Steffenrem Forsker, Skogfrøverket / NIBIO Generell presentasjon Skogplanteforedlingen i Midt- og Nord-Norge I samarbeid med Gisle

Detaljer

Økologiske og genetiske prosesser i naturlige bestander

Økologiske og genetiske prosesser i naturlige bestander Økologiske og genetiske prosesser i naturlige bestander 140 Antall voksne individer 120 100 80 60 40 0 1994 1996 1998 2000 2002 2004 2006 År Dr. Henrik Jensen Senter for bevaringsbiologi (CCB) NTNU, Trondheim

Detaljer

Matematisk evolusjonær genetikk (ST2301)

Matematisk evolusjonær genetikk (ST2301) Norges teknisk naturvitenskapelige universitet Institutt for matematiske fag Side 1 av 9 Matematisk evolusjonær genetikk (ST2301) Tirsdag 19. mai 2009 Løsningsforslag (For flere av oppgavene finnes det

Detaljer

Artikkelsamling: Strategi for skogplanteforedling 2010 2040

Artikkelsamling: Strategi for skogplanteforedling 2010 2040 Artikkelsamling: Strategi for skogplanteforedling 2010 2040 Innhold Genetisk variasjon i foryngelsesmaterialene og i foredlingspopulasjonen gjennom generasjoner... 2 Genetisk gevinst Det store foredlingsmålet!...

Detaljer

Frøtilgang og bruk på Østlandet Honne 4. april Øyvind Meland Edvardsen. Skogfrøverket

Frøtilgang og bruk på Østlandet Honne 4. april Øyvind Meland Edvardsen. Skogfrøverket Frøtilgang og bruk på Østlandet Honne 4. april 2017 - Øyvind Meland Edvardsen Skogfrøverket Millioner planter 120 Planteleveranser 1942-2016 100 80 Norsk frøplantasje 60 Importfrø Norsk bestandsfrø 2016

Detaljer

Foredling og skogskjøtsel for høyere produksjon av kvalitetsvirke De viktige valgene! Arne Steffenrem Skogfrøverket / Skog og landskap

Foredling og skogskjøtsel for høyere produksjon av kvalitetsvirke De viktige valgene! Arne Steffenrem Skogfrøverket / Skog og landskap Foredling og skogskjøtsel for høyere produksjon av kvalitetsvirke De viktige valgene! Arne Steffenrem Skogfrøverket / Skog og landskap 2009 Grana er anvendelig Foredling er veldig langsiktig: Hva etterspørres

Detaljer

Ny kunnskap i avlsprogram. Anna K. Sonesson

Ny kunnskap i avlsprogram. Anna K. Sonesson Ny kunnskap i avlsprogram Anna K. Sonesson Avlsprogram Design: strategien som brukes for å forbedre genetiske anlegg Avlsverdiberegning/seleksjonskriterium Avlsmål/ definisjon av egenskaper Nye teknikker

Detaljer

Hvor er responsen når vi ikke bruker den? Tore Vignes og Stein Evensen

Hvor er responsen når vi ikke bruker den? Tore Vignes og Stein Evensen Hvor er responsen når vi ikke bruker den? Tore Vignes og Stein Evensen Responser Noen bruker vi hele tiden Noen bruker vi sjelden Noen har vi nesten ikke brukt! Where is the f.. response!? Klasser Funksjonelle

Detaljer

FLERVALGSOPPGAVER EVOLUSJON

FLERVALGSOPPGAVER EVOLUSJON FLERVALGSOPPGAVER EVOLUSJON FLERVALGSOPPGAVER FRA EKSAMEN I BIOLOGI 2 V2008 - V2011 Disse flervalgsoppgavene er hentet fra eksamen i Biologi 2 del 1. Det er fire (eller fem) svaralternativer i hver oppgave,

Detaljer

GRUNNLEGGENDE GENETISKE BEGREPER Del I - en serie om kattegenetikk

GRUNNLEGGENDE GENETISKE BEGREPER Del I - en serie om kattegenetikk GRUNNLEGGENDE GENETISKE BEGREPER Del I - en serie om kattegenetikk Dette er første del i en serie om kattegenetikk. I denne første delen vil jeg ta for meg de ulike genetiske begrepene som blir brukt i

Detaljer

Løsningsforslag ST2301 Øving 4

Løsningsforslag ST2301 Øving 4 Løsningsforslag ST301 Øving 4 Kapittel 1 Complement Anta at det er n allel med samme frekvens. Som funksjon av n, hva er andelen homozygoter og heterozygoter i populasjonen? Har at p 1 p... p n p p i p

Detaljer

Genetisk variasjon, betydning for bestanders overlevelse og avgjørende for vellykket kultivering

Genetisk variasjon, betydning for bestanders overlevelse og avgjørende for vellykket kultivering Genetisk variasjon, betydning for bestanders overlevelse og avgjørende for vellykket kultivering Sten Karlsson Storørreten en glemt nasjonalskatt, Lillehammer 23-24 november 216 Viktige momenter ved utsetting

Detaljer

Repetisjonsark til vurdering i naturfag Celler og arv. Kap.1 Celler og arv Kjenneteikn på levande organismar S. 7-8

Repetisjonsark til vurdering i naturfag Celler og arv. Kap.1 Celler og arv Kjenneteikn på levande organismar S. 7-8 Repetisjonsark til vurdering i naturfag Celler og arv Læringsmål: Forklare kva som kjenneteiknar levande organismar Kunne skildre oppbygginga av dyre- og planteceller Forklare hovudtrekka i fotosyntese

Detaljer

Øystein Johnsen Norsk institutt for skog og landskap

Øystein Johnsen Norsk institutt for skog og landskap Hvilken risiko tar den enkelte skogeier ved å la pris styre valget av plantemateriale, og hvilke konsekvenser kan konkurransen få for norske skoger på sikt? Øystein Johnsen Norsk institutt for skog og

Detaljer

Foredling av gran på Vestlandet. Jan-Ole Skage, Skog og landskap, RKV på Fana

Foredling av gran på Vestlandet. Jan-Ole Skage, Skog og landskap, RKV på Fana Foredling av gran på Vestlandet Jan-Ole Skage, Skog og landskap, RKV på Fana Bakgrunn > I skogbrukssammenheng er Vestlandet spesielt på mange måter. > Viktigst er nok det store produksjonspotensialet,

Detaljer

Forskning. FORSKNING - Copyright 2015 Skogplanteforedling.no

Forskning. FORSKNING - Copyright 2015 Skogplanteforedling.no Forskning Introduksjon side. 1 Grunnleggende foredlingsforskning: Genetisk variasjon side. 2 Ettereffektene side. 3 Woven side. 4 WoodRes side. 5 Nyfrø side. 6 Markørassistert foredling I side. 7 Markørassistert

Detaljer

Skogplanteforedling og skogskjøtsel

Skogplanteforedling og skogskjøtsel Skogplanteforedling og skogskjøtsel for klimavennlig verdiskaping i skogen Arne Steffenrem Skogfrøverket / Skog og landskap For KOLA VIKEN Kolbotn 20.10.2011 Skogen som klimaregulator > Mange offentlige

Detaljer

Kapittel 10, del 2: Klassisk genetikk: Mendels arvelover. -forhold som influerer fenotypen slik at den avviker fra det Mendel observerte:

Kapittel 10, del 2: Klassisk genetikk: Mendels arvelover. -forhold som influerer fenotypen slik at den avviker fra det Mendel observerte: Kapittel 10, del 2: Klassisk genetikk: Mendels arvelover -forhold som influerer fenotypen slik at den avviker fra det Mendel observerte: 1. Dominansforhold 2. Multiple allel 3. Geninteraksjon 4. Genuttrykk

Detaljer

Genetiske interaksjoner villfisk-oppdrettsfisk

Genetiske interaksjoner villfisk-oppdrettsfisk Genetiske interaksjoner villfisk-oppdrettsfisk Jørgen Ødegård og Celeste Jacq Nofima AHA Oppstartkonferanse Leikanger, april 2011 Rømming av oppdrettslaks - trusselbilde Oppdrettsfisk kan rømme og krysse

Detaljer

EKSAMENSOPPGAVE I BI3010 Populasjonsgenetikk (Population genetics) BOKMÅL SPØRSMÅL 1-7 VEIER LIKT

EKSAMENSOPPGAVE I BI3010 Populasjonsgenetikk (Population genetics) BOKMÅL SPØRSMÅL 1-7 VEIER LIKT http://www.ntnu.no/trondheim-marine-ri/ Norges teknisk-naturvitenskapelige universitet Institutt for Biologi EKSAMENSOPPGAVE I BI3010 Populasjonsgenetikk (Population genetics) - Faglig kontakt under eksamen

Detaljer

Hvordan drive en god fiskekultivering i ei lakseelv? Årsmøte NL 24.mai 2016 Drammen Anne Kristin Jøranlid

Hvordan drive en god fiskekultivering i ei lakseelv? Årsmøte NL 24.mai 2016 Drammen Anne Kristin Jøranlid Hvordan drive en god fiskekultivering i ei lakseelv? Årsmøte NL 24.mai 2016 Drammen Anne Kristin Jøranlid Kort om retningslinjene Genetisk veileder Opphavskontrollen Retningslinjer for utsetting av anadrom

Detaljer

Kvalitetsmelk Potensialet i bevaringsdyktige storferaser

Kvalitetsmelk Potensialet i bevaringsdyktige storferaser Kvalitetsmelk Potensialet i bevaringsdyktige storferaser Prof. Gerd E.Vegarud Institutt for Kjemi, Bioteknologi og Matvitenskap, Universittetet for Miljø og Biovitenskap, Ås, 2111 2005 Innhold Melkesammensetning

Detaljer

Oppgave 2b V1979 Hvor i cellen foregår proteinsyntesen, og hvordan virker DNA og RNA i cellen under proteinsyntesen?

Oppgave 2b V1979 Hvor i cellen foregår proteinsyntesen, og hvordan virker DNA og RNA i cellen under proteinsyntesen? Bi2 «Genetikk» [3B] Målet for opplæringa er at elevane skal kunne gjere greie for transkripsjon og translasjon av gen og forklare korleis regulering av gen kan styre biologiske prosessar. Oppgave 2b V1979

Detaljer

FYLKESMANNEN I SOGN OG FJORDANE. NMSK skogkultur m.m. Frist for å melde forbruk: 1. august

FYLKESMANNEN I SOGN OG FJORDANE. NMSK skogkultur m.m. Frist for å melde forbruk: 1. august NMSK skogkultur m.m. Frist for å melde forbruk: 1. august Dette er ståa Frå statistikken 2014 120 planting 411 100 1784 da 125 juletre 17 900 130 supplering 6 800 131 mek etterarb 62! 133 avstandsreg 61!

Detaljer

Rettet avskytning er det rett avskytning?

Rettet avskytning er det rett avskytning? Rettet avskytning er det rett avskytning? - hva vi har lært fra jaktlaboratoriet på Vega Stine Svalheim Markussen Jaktlaboratoriet Vega: Rettet avskytning 1. Rettet avskytning av elg 2. Vega-populasjonen:

Detaljer

Avlsarbeidet til Norges Birøkterlag og bruk av BEEBREED

Avlsarbeidet til Norges Birøkterlag og bruk av BEEBREED Bjørn Dahle Avlsarbeidet til Norges Birøkterlag og bruk av BEEBREED Seniorrådgiver Norges Birøkterlag Førsteamanuensis II Institutt for Husdyrfag og Akvakulturvitenskap Norges Miljø og Biovitenskapelige

Detaljer

BIO 1000 LAB-ØVELSE 1

BIO 1000 LAB-ØVELSE 1 Navn: Parti: Journalen leveres senest tirsdag 13. September 2005 i kassen utenfor labben. BIO 1000 LAB-ØVELSE 1 MENDELSK GENETIKK 6. september 2005 Faglig ansvarlig: Hovedansvarlig for lab-øvelsen: Øystein

Detaljer

Genetiske interaksjoner: Kunnskapsstatus og innblanding av oppdrettsfisk i elvene. Kevin A. Glover Ø. Skaala, V. Wennevik G.L. Taranger og T.

Genetiske interaksjoner: Kunnskapsstatus og innblanding av oppdrettsfisk i elvene. Kevin A. Glover Ø. Skaala, V. Wennevik G.L. Taranger og T. Genetiske interaksjoner: Kunnskapsstatus og innblanding av oppdrettsfisk i elvene Kevin A. Glover Ø. Skaala, V. Wennevik G.L. Taranger og T. Svåsand Bakgrunn Norge er verdens største produsent av atlantisk

Detaljer

Populasjonsgenomikk på torsk -et verktøy for identifisering av viktige genomiske regioner for oppdrettsnæringen.

Populasjonsgenomikk på torsk -et verktøy for identifisering av viktige genomiske regioner for oppdrettsnæringen. Programkonferansen HAVBRUK 2012, Stavanger, 16.-18. april 2012 Populasjonsgenomikk på torsk -et verktøy for identifisering av viktige genomiske regioner for oppdrettsnæringen. Paul R. Berga, Bastiaan Stara,

Detaljer

NIBIO POP. Genetisk variasjon i ask

NIBIO POP. Genetisk variasjon i ask VOL 3 - NR. 5 - FEBRUAR 2017 En av våre nordligste askeskoger, Hindrum i Nord-Trøndelag. Foto: Arne Steffenrem, NIBIO Genetisk variasjon i ask De norske askeskogene er en nordlig utløper av større askeskoger

Detaljer

Avl på Norsk melkegeit

Avl på Norsk melkegeit Avl på Norsk melkegeit Friskere geiter, 22. november 2011 Thor Blichfeldt Avls- og seminsjef Norsk Sau og Geit Avlsarbeidet - grunnleggende Kvantitative egenskaper Avlsarbeidet utnytter genetisk variasjon

Detaljer

UNIVERSITETET I AGDER

UNIVERSITETET I AGDER FAKULTET FOR TEKNOLOGI OG REALFAG EKSAMEN Emnekode: BI0105 Emnenavn: Genetikk og evolusjon Dato: 21. november 2011 Varighet: 2 timer Antall sider inkl. forside 8 Tillatte hjelpemidler: Kalkulator Merknader:

Detaljer

Trær i Kulturlandskapet. Arne Sæbø

Trær i Kulturlandskapet. Arne Sæbø Trær i Kulturlandskapet Arne Sæbø Trærne i kulturlandskapet; Problem, utfordring eller mulighet? Globalisering Nasjonal politikk NO x og Klima Privatøkonomiske valg og prioriteringer Gjengroing i norske

Detaljer

Skogplanteforedling og skogskjøtsel viktig kombinasjon for klimavennlig verdiskaping i skogen

Skogplanteforedling og skogskjøtsel viktig kombinasjon for klimavennlig verdiskaping i skogen Skogplanteforedling og skogskjøtsel viktig kombinasjon for klimavennlig verdiskaping i skogen Arne Steffenrem 12, Øyvind Meland Edvardsen 2, Harald Kvaalen 1 1) Skog og landskap 2) Skogfrøverket Kvatninga

Detaljer

Foredlingsstrategi i utvikling. Arne Steffenrem og Øyvind Meland Edvardsen (Skog og landskap og Skogfrøverket)

Foredlingsstrategi i utvikling. Arne Steffenrem og Øyvind Meland Edvardsen (Skog og landskap og Skogfrøverket) Foredlingsstrategi i utvikling Arne Steffenrem og Øyvind Meland Edvardsen (Skog og landskap og Skogfrøverket) Strategi(for(skogplanteforedling(2010(4(2040( Strategiprosess+i+2007/2009+ Foredlere'og'forskere'i'Skogfrøverket'og'

Detaljer

Demodex (hårsekkmidd) Det latinske navnet på hunders hårsekkmidd. Sykdommen, som er en midd, forårsaker demodekose.

Demodex (hårsekkmidd) Det latinske navnet på hunders hårsekkmidd. Sykdommen, som er en midd, forårsaker demodekose. NKKs Oppdretterskole - Del 1: Genetikk og avl Bergen 14. og 15. november 2009 Forelesere: Astrid Indrebø og Hilde Bremnes Referat ved Solvor Nærland Genetikk og avl Hunder har 78 kromosomer: - Autosomer

Detaljer

DNA-profiler. DNA analyse fra ekskrementer. Foredragets oppbygning. DNA framtidens overvåkingsmetodikk på store rovdyr?

DNA-profiler. DNA analyse fra ekskrementer. Foredragets oppbygning. DNA framtidens overvåkingsmetodikk på store rovdyr? DNA framtidens overvåkingsmetodikk på store rovdyr? Øystein Flagstad Foredragets oppbygning Generell innledning; metodikk og aktuelle problemstillinger Case study; bestandsovervåkning av jerv Videreutvikling

Detaljer

Indekser i avlsarbeidet: Kan vi se om de virker? Jørgen Ødegård Avlsforsker

Indekser i avlsarbeidet: Kan vi se om de virker? Jørgen Ødegård Avlsforsker Indekser i avlsarbeidet: Kan vi se om de virker? Jørgen Ødegård Avlsforsker Gentisk fremgang Hver generasjon står på skulderne til forrige generasjon Fremgangen er varig Selv om avlsarbeidet skulle stoppe

Detaljer

Holder cytoplasmaet på plass. Regulerer transporten inn i og ut av cellen og har kontakt med naboceller.

Holder cytoplasmaet på plass. Regulerer transporten inn i og ut av cellen og har kontakt med naboceller. Figurer kapittel 7 Fra gen til egenskap Figur s. 189 elledel ellemembran ytoplasma Lysosom Ribosom Mitokondrie Kanalnettverk (endoplasmatisk nettverk) Kjernemembran ellekjerne rvestoff (= DN) Molekyl Protein

Detaljer

Nytt frø, nye egenskaper

Nytt frø, nye egenskaper Nytt frø, nye egenskaper Arne Steffenrem Skogfrøverket / Skog og landskap NordGen Skogs temadag, Gardermoen 22. mars 2011 Bakgrunn > 2006: Svært godt frøår og stor frøsanking over hele Østlandet og i Midt-Norge.

Detaljer

Rømming 1-2015 Sporing av rømt oppdrettslaks fanget i Ørstaelva høsten 2015

Rømming 1-2015 Sporing av rømt oppdrettslaks fanget i Ørstaelva høsten 2015 Rømming 1-2015 Sporing av rømt oppdrettslaks fanget i Ørstaelva høsten 2015 Wennevik, V., Quintela, M., Sørvik, A.G.E., Skaala, Ø., Glover, K.A. Havforskningsinstituttet, Postboks 1870, Nordnes, 5817 Bergen

Detaljer

Genetiske interaksjoner mellom vill og oppdrettet laks

Genetiske interaksjoner mellom vill og oppdrettet laks Genetiske interaksjoner mellom vill og oppdrettet laks Céleste Jacq, Jørgen Ødegård, Hans B. Bentsen og Bjarne Gjerde Havforskermøtet 2011 Trondheim Rømming av oppdrettslaks - trusselbilde Oppdrettsfisk

Detaljer

Arktisk landbruk 2009 Plantesorter i endret klima Hva klarer plantene?

Arktisk landbruk 2009 Plantesorter i endret klima Hva klarer plantene? Arktisk landbruk 2009 Plantesorter i endret klima Hva klarer plantene? Odd Arne Rognli 1 og Tore Skrøppa 2 1 Institutt for plante- og miljøvitenskap (IPM), Universitetet for miljøog biovitenskap; 2 Norsk

Detaljer

Oppdretterseminar 20 21/3, i forbindelse med NBaK s årsmøte 2010. Genetikk og avl for hund II, v/ Hanna Helgeland.

Oppdretterseminar 20 21/3, i forbindelse med NBaK s årsmøte 2010. Genetikk og avl for hund II, v/ Hanna Helgeland. Oppdretterseminar 20 21/3, i forbindelse med NBaK s årsmøte 2010. Genetikk. Genetikk og avl for hund II, v/ Hanna Helgeland. Grunnleggende begreper innen arvelære. Referat: Per Hoff Gener: Områder i DNA

Detaljer

Langsiktige endringer i biomangfold - paleoøkologiske resultater

Langsiktige endringer i biomangfold - paleoøkologiske resultater WWW.BJERKNES.UIB.NO Langsiktige endringer i biomangfold - paleoøkologiske resultater Anne E. Bjune Bjerknessenteret for Klimaforskning & Uni Research AS Oppsett Motivasjon hvorfor trenger vi paleodata?

Detaljer

Løsningsforslag ST2301 Øving 10

Løsningsforslag ST2301 Øving 10 Løsningsforslag ST2301 Øving 10 Kapittel 5 Exercise 6 Hva er innavlskoeffisienten for individ I i følgende stamtre? Svar: Her er det best å bruke en annen metode enn løkkemetoden. Slektskapskoeffisientmetoden

Detaljer

Skogplanteforedling i Norge Nå og i fremtiden!

Skogplanteforedling i Norge Nå og i fremtiden! Skogplanteforedling i Norge Nå og i fremtiden! Arne Steffenrem, Skogfrøverket og Skog og landskap Øyvind Meland Edvardsen, Skogfrøverket NordGen temadag, Stockholm 28. mars 2012 μ B μn μ S > Behövs förädling

Detaljer

Løsningsforslag ST2301 Øving 2

Løsningsforslag ST2301 Øving 2 Løsningsforslag ST2301 Øving 2 Kapittel 1 Exercise 6 Har et utvalg på 200 individer, fra en populasjon med forventet Hardy-Weinbergandeler for et locus med tre alleler, A 1, A 2 og A 3. Antall individer

Detaljer

Strategi for skogplanteforedling

Strategi for skogplanteforedling Strategi for skogplanteforedling 2010 2040 Strategiprosessen Grundig prosess med workshop og høring, men som har tatt tid! Svært positive tilbakemeldinger fra skognæring og skogforvaltning Skogbruket ønsker

Detaljer

Karplanter har overlevd i Norge under siste istid

Karplanter har overlevd i Norge under siste istid Foto: Kristine Bakke Westergaard. Karplanter har overlevd i Norge under siste istid For rundt tre millioner år siden ble temperaturen på Jorda lavere, og skogene som tidligere dekket den nordlige halvkule,

Detaljer

Askeskuddsjuke; hva vet vi og hva gjør vi? Halvor Solheim, Volkmar Timmermann, Mari Mette Tollefsrud

Askeskuddsjuke; hva vet vi og hva gjør vi? Halvor Solheim, Volkmar Timmermann, Mari Mette Tollefsrud Askeskuddsjuke; hva vet vi og hva gjør vi? Halvor Solheim, Volkmar Timmermann, Mari Mette Tollefsrud Utbredelsen til vanlig ask i Europa fra EUFORGEN Tidlig/midt 1990-tallet Først Polen, så Litauen Sent-1990-

Detaljer

Landsmøte for nordlandshest/lyngshest

Landsmøte for nordlandshest/lyngshest Foto:Jørgensen Landsmøte for nordlandshest/lyngshest Anna Rehnberg, Sola, 22.03.2015 Organisasjonskart for arbeidet med genetiske ressurser i Norge Landbruks- og matdepartementet (LMD) Norsk institutt

Detaljer

Kleng. Frøavl NORSK PERSPEKTIV PÅ NORDISK SAMARBEID I SKOGFRØ- FORSYNINGEN. Rapport 07/2015. Foredling. fra Skog og landskap

Kleng. Frøavl NORSK PERSPEKTIV PÅ NORDISK SAMARBEID I SKOGFRØ- FORSYNINGEN. Rapport 07/2015. Foredling. fra Skog og landskap Rapport 07/2015 fra Skog og landskap ----------------------------------------------------------------------------------------------------------------- NORSK PERSPEKTIV PÅ NORDISK SAMARBEID I SKOGFRØ- FORSYNINGEN

Detaljer

Status i forskning: Demens og arvelighet. Arvid Rongve Psykiatrisk Klinikk Helse Fonna

Status i forskning: Demens og arvelighet. Arvid Rongve Psykiatrisk Klinikk Helse Fonna Status i forskning: Demens og arvelighet Arvid Rongve Psykiatrisk Klinikk Helse Fonna Arvelighet og genetiske metoder Alzheimers sykdom og arvelighet Hva kan vi lære av de nye genene? Betydning for behandling

Detaljer

Vinst ved foredling av skogstre. Harald H Kvaalen Skog og landskap, Ås

Vinst ved foredling av skogstre. Harald H Kvaalen Skog og landskap, Ås Vinst ved foredling av skogstre Harald H Kvaalen Skog og landskap, Ås Tema Foredling og frøplantasjar Auka vekst Betre kvalitet Auka karbonbinding Utvalg 20 25 % Evaluering Genetisk tynning Foredling Frøplantasjer/arkiver

Detaljer

Hva gjør Norsvin for å forbedre egenskapene til purka?

Hva gjør Norsvin for å forbedre egenskapene til purka? Hva gjør Norsvin for å forbedre egenskapene til purka? Ina Andersen-Ranberg 1 og Dan Olsen 1 Norsvin Hybridpurka Mesteparten av svineproduksjonen er i bruksbesetningene og i disse besetningene er vanligvis

Detaljer

Strategi for skogplanteforedling 2010-2040

Strategi for skogplanteforedling 2010-2040 Strategi for skogplanteforedling 2010-2040 Kaupanger frøplantasje i Sogn. Et viktig anlegg for forsyning av frø for høyereliggende skog. Foto: Øyvind Meland Edvardsen, Skogfrøverket Høringsfrist 25. september

Detaljer

Avl på ferskvannsarter, vil det kunne bli en realitet i Norge? Av Terje Refstie Akvaforsk Genetics Center AS

Avl på ferskvannsarter, vil det kunne bli en realitet i Norge? Av Terje Refstie Akvaforsk Genetics Center AS Avl på ferskvannsarter, vil det kunne bli en realitet i Norge? Av Terje Refstie Akvaforsk Genetics Center AS Avlsmetoder. Reinavl Krysningsavl Betinger heterosis Innavl Fører til innavlsdepresjon Reinavl.

Detaljer

Grothøsting i slutthogst og tynning - effekter på foryngelse og skogproduksjon. Sluttseminar 12. februar 2014 Kjersti Holt Hanssen Skog og landskap

Grothøsting i slutthogst og tynning - effekter på foryngelse og skogproduksjon. Sluttseminar 12. februar 2014 Kjersti Holt Hanssen Skog og landskap Foto: Kjersti Holt Hanssen Foto: K. H. Hanssen Grothøsting i slutthogst og tynning - effekter på foryngelse og skogproduksjon Sluttseminar 12. februar 2014 Kjersti Holt Hanssen Skog og landskap Oversikt

Detaljer

DRONENE BIFOLKETS HANNBIER

DRONENE BIFOLKETS HANNBIER DRONENE - BIFOLKETS HANNBIER 1 DRONENE BIFOLKETS HANNBIER Bifolkets hannbier dronene blir av de fleste birøktere sett på som en belastning i bisamfunnet, idet de spiser mye honning uten å bidra med noe

Detaljer

Flervalgsoppgaver: proteinsyntese

Flervalgsoppgaver: proteinsyntese Flervalgsoppgaver - proteinsyntese Hver oppgave har ett riktig svaralternativ. Proteinsyntese 1 Hva blir transkribert fra denne DNA sekvensen: 3'-C-C-G-A-A-T-G-T-C-5'? A) 3'-G-G-C-U-U-A-C-A-G-5' B) 3'-G-G-C-T-T-A-C-A-G-5'

Detaljer

IPN og spredning: Hvor viktig er stamme?

IPN og spredning: Hvor viktig er stamme? IPN og spredning: Hvor viktig er stamme? Nina Santi Aqua Gen AS Disposisjon Viktig å vite om IPN viruset Ulike stammer av IPN viruset IPN forebygging i settefiskanlegget 1 Virus Arvemateriale: DNA eller

Detaljer

Forvaltning av moskus på Dovrefjell

Forvaltning av moskus på Dovrefjell 1 Forvaltning av moskus på Dovrefjell Bjørn Rangbru Fylkesmannen i Sør-Trøndelag Hjerkinn 2. juni 2015 2 Rein Utbredelse Moskus (blå utsatt) Moskus lever lenger nord 3 Forvaltning av moskus på Dovrefjell

Detaljer

Norsk planteforedling i et endret klima

Norsk planteforedling i et endret klima Norsk planteforedling i et endret klima Odd Arne Rognli, Institutt for plantevitenskap, NMBU 25.03.2015 Kilde: Petter Marum, Graminor Kilde: Petter Marum, Graminor Kilde: Petter Marum, Graminor Biologisk

Detaljer

Løsningsforslag ST2301 Øving 2

Løsningsforslag ST2301 Øving 2 Løsningsforslag ST2301 Øving 2 Kapittel 1 Exercise 6 Har et utvalg på 200 individer, fra en populasjon med forventa Hardy-Weinbergandeler for et locus med tre alleler, A 1, A 2 og A 3. Antall individer

Detaljer

EKSAMENSOPPGAVE I BI3010 (POPULASJONSGENETIKK)

EKSAMENSOPPGAVE I BI3010 (POPULASJONSGENETIKK) Norges teknisk-naturvitenskapelige universitet Institutt for (INSTITUTTNAVN) EKSAMENSOPPGAVE I BI3010 (POPULASJONSGENETIKK) - Faglig kontakt under eksamen (Contact persons during exam): J. Mork (909 73

Detaljer

Løsningsforslag ST2301 Øving 6

Løsningsforslag ST2301 Øving 6 Løsningsforslag ST230 Øving 6 Kapittel 2 Exercise 0 Anta at tre genotyper har fitnesser A A A A 2 A 2 A 2 4 0 3. Hva er likevektsfrekvensen? 2. Er denne stabil? 3. Hvorfor kan vi ikke bare bruke formlene

Detaljer

Småblank i øvre Namsen er truet av kraftutbygging. Ole Kristian Berg, Biologisk Institutt, NTNU Norges teknisk-naturvitenskapelige universitet

Småblank i øvre Namsen er truet av kraftutbygging. Ole Kristian Berg, Biologisk Institutt, NTNU Norges teknisk-naturvitenskapelige universitet Småblank i øvre Namsen er truet av kraftutbygging Ole Kristian Berg, Biologisk Institutt, NTNU Norges teknisk-naturvitenskapelige universitet 1.Småblank eller namsblank? Aure eller småblank? 2.Biologi

Detaljer

Faglig kontaktperson under eksamen: 1.aman. Hans K. Stenøien ( )

Faglig kontaktperson under eksamen: 1.aman. Hans K. Stenøien ( ) Side 1 av 11 Norges teknisknaturvitenskapelige universitet Fakultet for naturvitenskap og teknologi Institutt for biologi Faglig kontaktperson under eksamen: 1.aman. Hans K. Stenøien (91897592) EKSAMEN

Detaljer

Foredling, gran Foredlingsmøte, Hamar, 2. desember Ragnar Johnskås, Torstein Myhre, Jan Ole Skage og Arne Steffenrem

Foredling, gran Foredlingsmøte, Hamar, 2. desember Ragnar Johnskås, Torstein Myhre, Jan Ole Skage og Arne Steffenrem Foredling, gran Foredlingsmøte, Hamar, 2. desember 2014 Ragnar Johnskås, Torstein Myhre, Jan Ole Skage og Arne Steffenrem Frøplantasjer Pluss-tre utvalg 1. generasjon 1950-1998 1985-2030 Nye og bedre plantasjer

Detaljer

Mal for vurderingsbidrag

Mal for vurderingsbidrag Mal for vurderingsbidrag Fag: Naturfag Tema: Tar for seg følgende i lærerplanen. Beskrive oppbygningen av dyreceller. Gjøre greie for celledeling samt genetisk variasjon og arv. Temaet brukes ofte som

Detaljer

Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser

Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser PEDENDO_SISTE_slutt.qxd 18.12.2003 21:34 Side 32 Pediatrisk Endokrinologi 2003;17: 34-38 Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser Pål Rasmus Njølstad 1,2,3,Jørn V. Sagen

Detaljer

Idrett og energiomsetning

Idrett og energiomsetning 1 Medisin stadium IA, Tonje S. Steigedal 2 ATP er den eneste forbindelsen som kan drive kontraksjon av musklene. ATPnivået i muskelcellene er imidlertid begrenset, og må etterfylles kontinuerlig. Ved ulike

Detaljer

Handlingsplan for bevaring av genetiske ressurser hos skogstrær i Norge 2003-2006

Handlingsplan for bevaring av genetiske ressurser hos skogstrær i Norge 2003-2006 Handlingsplan for bevaring av genetiske ressurser hos skogstrær i Norge 2003-2006 Tor Myking og Tore Skrøppa, Skogforsk Vedtatt på møte i Genressursutvalget for skogstrær 29. januar 2003 Innledning Et

Detaljer

NIDNA. Foredrag: DNA og slektsforskning. Av: David Widerberg Howden. Norgesprosjektet-DNA.

NIDNA. Foredrag: DNA og slektsforskning. Av: David Widerberg Howden. Norgesprosjektet-DNA. Norgesprosjektet-DNA NIDNA www.norwaydna.no Foredrag: DNA og slektsforskning Av: David Widerberg Howden NSF Trøndelag Gunnerusbiblioteket 20.09.2016 Hvilke tester finnes? Meg Pappa Var jeg egentlig i

Detaljer

Skogbruk i endra klima,

Skogbruk i endra klima, Skogbruk i endra klima, potensial og politikk Adaptiv skogbehandling - dyd av nødvendighet? Bernt-Håvard Øyen, Spesialrådgiver, Skognæringa Kyst Hvor store endringer ligger det an til? Kilde: NASA (mai

Detaljer

Time 3. Biodiversitet og innvandring

Time 3. Biodiversitet og innvandring Time 3 Biodiversitet og innvandring Hvorfor bevare mangfoldet? Mange arter avhenger av hverandre Artsrike økosystemer er mer robuste ved endringer i miljøet Arter representerer fremtidig ukjente verdier

Detaljer

Genetikk og psykiatriske lidelser Hvilke sammenhenger ser man?

Genetikk og psykiatriske lidelser Hvilke sammenhenger ser man? Genetikk og psykiatriske lidelser Hvilke sammenhenger ser man? Ted Reichborn-Kjennerud, dr. med. Avdeling for psykisk helse Nasjonalt Folkehelseinstitutt Arv og miljø Genetiske ulikheter har lenge vært

Detaljer

Foto: Hans Olav H. Egge. Norges lengste lindeallé på Hoel gård, på Nes på Hedmarken.

Foto: Hans Olav H. Egge. Norges lengste lindeallé på Hoel gård, på Nes på Hedmarken. æ Foto: Hans Olav H. Egge. Norges lengste lindeallé på Hoel gård, på Nes på Hedmarken. 1 Innledning... 3 Genetiske ressurser... 3 Oppfølging av internasjonale forpliktelser... 3 Norsk genressurssenter

Detaljer