GENER, genregulering, og genfamilier

Save this PDF as:

Størrelse: px
Begynne med side:

Download "GENER, genregulering, og genfamilier"


1 GENER, genregulering, og genfamilier 1-A, H-11 Forelesning Frank Skorpen, Institutt for Laboratoriemedisin, Barne- og Kvinnesykdommer, DMF, NTNU Gener Kromosom, kromatin og DNA Hva er et gen? Hvor mange gener har vi? Struktur og funksjon Genregulering Transkripsjon Signalaktivering Geners regulatoriske områder Transkripsjonsfaktorer Genfamilier Hovedmekanismer for utvikling Eksempler I hver celle i kroppen finnes over 2 m med DNA. DNA finnes i cellekjernen, og noe i mitokondrier. For å få plass er DNA tett pakket i høyere-ordens strukturer Hollow tube: 300 nm i diameter Solenoid: 30 nm i diameter 1

2 Kromosomer består av DNA og protein Chromatin fiber: 10 nm i diameter Nukleosom DNA dobbel-helix ca 2 nm i diameter I hver celle i kroppen finnes 2,16m med DNA! Dette skal få plass i cellekjernen, med diameter ~5µm. Hvor mye DNA er det i en 1 AU = km (~150 mill km) 2

3 144 x 150 mill km mill km!. DNA dobbel-tråden holdes sammen av bindinger mellom basepar (A:T og G:C) Met -Leu -Gly Gener er organisert som perler på en snor langs kromosomene. Den gamle definisjonen: Segment av genomisk DNA som koder for en polypeptidkjede eller spesifiserer et funksjonelt RNA molekyl. En nyere (mer upresis) definisjon: Segment av genomisk DNA eller RNA som utfører en bestemt funksjon. Trenger ikke være transkribert eller translatert. 3

4 Press Releases: 14th April 2003 Humane genom Nukleære genom 3.3 milliarder baser Mitokondrielle genom baser 37 gener ~25% ~75% Gener og genrelaterte sekvenser DNA utenfor gener ~ 10% ~ 90% Kodende DNA (~2.5% av tot.) Ikke-kodende DNA Mennesket har ca gener Drosophila melanogaster Caenorhabditis elegans Human ~ ~ forskj. proteiner 4

5 Gener består av exons og introns 5 Promoter Exon Intron Exon Intron Exon 3 EXON : kodende DNA INTRON : ikke-kodende DNA PROMOTER: område for binding av transkripsjonsfaktorer og RNA polymerase Promoter Intron 5 Exon Exon Exon 3 Pre-mRNA cap AAAAAA-3 Fjerning av introns, Spleising av exons mrna 5 cap AAAAAA-3 CYTOPLASMA Alternativ spleising av exons åpner for produksjon av flere ulike proteiner fra samme gen. 5 Exon 3 mrna Protein 5 -cap AAA-3 A A 5 -cap AAA-3 B B 5 -cap AAA-3 C C 5

6 Ikke alle gener koder for protein mrna : messenger RNA; koder for aminosyrene i et polypeptid trna : transfer RNA; bringer aminosyrene til ribosomer under translasjon rrna ; ribosomal RNA; del av ribosom (som oversetter mrna til polypeptid) snrna : small nuclear RNA; danner komplekser med proteiner (eks. i spleiseproteiner ) Alle celler i kroppen inneholder de samme genene. Likevel inneholder ulike celletyper ulike sett av proteiner. Celletype 1 Celletype 2 Gener Alle celler i kroppen inneholder de samme genene. Likevel inneholder ulike celletyper ulike sett av proteiner. Celletype 1 Celletype 2 Gener Proteiner 6

7 Alle celler i kroppen inneholder de samme genene. Likevel inneholder ulike celletyper ulike sett av proteiner. Celletype 1 Celletype 2 Gener Proteiner Ulike celletyper uttrykker ulike sett av gener. Typisk, til enhver tid er bare 3-5% av alle genene i bruk. Gener er ikke aktive hele tiden, men kan slås på av en rekke ulike signaler CELLULÆRE FORHOLD Regulering av gen-uttrykk YTRE FAKTORER G1 M S G2 TRANSKRIPSJON Hormoner/vekstfaktorer Sol-lys Berøring Smerte Næringsstoffer/ vitaminer Betennelse Virus Organiske/uorganiske signalmolekyler Eksempel på overføring av ytre signaler til cellekjernen Lipofile molekyler 7

8 Gen-uttrykket kan kontrolleres på minst 5 nivåer Dominerende nivå Geners regulatoriske områder 5 Promoter Intron GEN Exon 3 AKTIVATORER (~6-12 bp) Distale Proximale ENHANCER ELEMENTER TATA -25 CORE PROMOTER Start +1 Transkripsjonsfaktorer (aktivatorer) har minst tre funksjonelle domener Aktiveringsdomene P P Transkripsjonsfaktorer foreligger som oftest i en inaktiv form, og blir aktivert av signaler. Transkripsjonsmaskineri Dimeriseringsdomene eks.: - fosforylering - binding av ligand L L L T G C C G G C A DNA-bindingsdomene Når signalet opphører inaktiveres transkripsjonsfaktoren. 8

9 Transkripsjonsfaktorer (aktivatorer) har minst tre funksjonelle domener Aktiveringsdomene Transkripsjonsfaktorer foreligger som oftest i en inaktiv form, og blir aktivert av signaler. Dimeriseringsdomene eks.: - fosforylering - binding av ligand L L L T G C C G G C A DNA-bindingsdomene Når signalet opphører inaktiveres transkripsjonsfaktoren. Eksempel på klasser av transkripsjonsfaktorer Merk: de fleste aktive transkripsjonsfaktorer binder som dimerer. De kan være satt sammen av to identiske (homo-) eller to ulike (hetero-) subenheter. Eksempel på reseptor-mediert gen-aktivering Steroid hormon reseptor (inaktiv) Steroid hormon TRANSKRIPSJON P P P P Signalkaskade Insulin Insulin reseptor 9

10 Ulik oppbygging av regulatoriske områder danner grunnlag for individuell regulering av gener Ingen gener er eksakt lik i måten de regulatoriske områder er bygd opp på (dvs. i DNA sekvens). De vil derfor kunne binde ulike sett av transkripsjonsaktivatorer. Noen elementer kan være felles mellom ulike gener A B C Gen tttaaagtcccggggttataatccaattagatatag AF AA DD EE Gen 2 ---ccgcggtatttaaagttacacgtccaattagatatggac Ulike celletyper uttrykker forskjellige sett av gener, blant annet fordi de inneholder ulike sett av transkripsjonsfaktorer Celletype A Celletype B Uttrykte genprodukter Aktivatorer rekrutterer RNA pol II og et sett av 5 generelle transkripsjonsfaktorer. Disse er med i transkripsjon av alle gener. AKTIVATORER IID IIH IIE Transkripsjonsfaktorer Transkripsjonsmaskineri pol IIF RNA II IIB TATA Inr 10

11 Regulering av gen-ekspresjon: oppsummering Gen-ekspresjon initieres av signaler Signalene overføres vanligvis via membranbundne reseptorer, eller reseptorer i cytoplasma. Signalet når cellekjernen, og påvirker genuttrykk. Spesielle transkripsjonsfaktorer (aktivatorer) Ansvarlig for spesifikk regulering av transkripsjon. Binder til DNA i genets promoter. Rekrutterer transkripsjonsmaskineriet. Generelle transkripsjonsfaktorer: Ansvarlig for all transkripsjon. Er assosiert med RNA polymerase II, og bidrar til at denne binder korrekt til genets promoter. Utgjør sammen med RNA pol II transkripsjonsmaskineriet. Forskjellige gener aktiveres av ulike sett av transkripsjonsfaktorer (aktivatorer) Ingen gener er eksakt lik i måten promoteren er bygd opp. Hvert gen kan derfor reguleres spesifikt og individuelt. Ulike celler uttrykker ulike sett av gener, bl.a. fordi de inneholder ulike sett av transkripsjonsfaktorer Genfamilier Både mus, mennesker, bakterier som E.coli og andre former for liv har utviklet seg fra den samme stamfar for noen milliarder år siden. E.coli Gjær Humant 4.2 x 10 6 bp 1.2 x 10 7 bp 3.3 x 10 9 bp Hvor kommer så det ekstra DNAet som mennesker har fra? Svar: Vårt genom har vokst i størrelse gjennom en gjentagende prosess av duplisering og divergens. 11

12 Genomisk kompleksitet øker ved genduplisering og seleksjon for nye funksjoner 1. Duplisering ved ulik overkryssing gir opphav til gen- clusters (ansamlinger av like/beslektede gener) 2. Duplisering ved transponering gir spredning av like/beslektede gener Meiose Søsterkromatider 2 n Replikasjon Overkryssing (rekombinasjon) Meiose I Meiose II n Slik homolog rekombinasjon krever sekvenslikhet (homologi) mellom områder på kromosomene Duplisering ved ulik overkryssing Initiell duplisering av singel-kopi region C C C B A B A C A B Duplisert gen B A Seter for rekombinasjon 12

13 Videre ekspansjon fra en duplisert region Sete for overkryssing A B B C A B B C Overkryssing A B B/B B C Divergens (mutasjoner) A B1 B2 B3 C Genfamilie med 3 medl. β-globin heme HEMOGLOBIN α-globin Stamfar globin gen Duplikasjon Evolusjon Mutasjon Transponering α α β β Duplikasjon/ mutasjon ζ α ε γ β ζ 2 Ψ ζ1 Ψ α2 Ψ α1 α2 α1 θ ε Gγ Aγ Ψβ δ β α-globin gen familien (kromosom 16) β-globin gen familien (kromosom 11) 13

14 Uttrykket av de ulike globin-genene er regulert gjennom ulike trinn av utviklingene β-globin cluster Embryonalt DNA LCR ε Gγ Aγ Ψβ δ β Føtalt DNA LCR ε Gγ Aγ Ψβ δ β Voksent DNA LCR ε Gγ Aγ Ψβ δ β LCR: Locus control region Noen eksempler på clustered multigen familier Familie Kopier Komplement C4 gener 2 Vekst hormon gener 5 α-globin gener 7 Klasse HLA heavy chain ~20 HOX gener 38 Histon gener ~100 Duplisering ved transponering ( hoppende gener ) Humane genom Nukleære genom 3.3 milliarder baser gener Mitokondrielle genom baser 37 gener ~25% ~75% Gener og genrelaterte sekvenser DNA utenfor gener ~60% ~40% ~ 10% ~ 90% Kodende DNA (~2.5%) Ikke-kodende DNA Unikt- eller lavkopi DNA Repetetivt DNA 14

15 Repetetivt DNA finnes spredt rundt i genomet i stort antall Transposable elementer eks. Alu Slike elementer/sekvenser danner grunnlag for baseparing mellom ikke-homologe regioner, og kan resultere i ureglementert overkryssing mellom kromosomer, samt transponering av gener til andre kromosomale posisjoner. Eksempler på slike elementer er Alu, LINE, Mer, Mir. eks. kromosom 4 kromosom 11 Transposable elementer ble først beskrevet av Barbara McClintock sent på 1940 tallet. Ble først ignorert, men fikk senere Nobel prisen (1983). Inverted repeat Inverted repeat 5 3 ATCCGGT TAGGCCA ACCGGAT TGGCCTA 3 5 Transposabelt element (TE) TE GEN TE Transposabelt område Meiose (dannelse av kjønnsceller) Singel kopi 15

16 Økt mengde DNA β-globin 16

17 Mobile elementer (transposoner) kan forårsake sykdom Transposoner er mutagene. De kan skade genomet på ulike måter: Et transposon som setter seg selv inn i et gen vil mest sannsynlig inaktivere genet. Når et transposon forlater et gen, så vil hullet etter transposonet ikke alltid repareres korrekt. Mange kopier av et transposon, eks. Alu-sekvens, kan forstyrre korrekt paring av homologe kromosomer i mitose og meiose. Resultatet kan være ulik overkryssing, en av hovedårsakene for gen-duplikasjon. Genfamilier - oppsummering Det humane genom har ekspandert gjennom en gjentagende prosess av genduplisering og divergens Genomisk kompleksitet øker ved genduplisering og seleksjon for nye funksjoner To hovedmekanismer for genduplisering: ulik overkryssing mellom homologe kromosom transponering mellom kromosomer De fleste genduplikasjoner gir opphav til pseudogener, dvs. inaktive gener. 17

Regulering av DNA Transkripsjon i Eukaryote Organismer. ID, Kull 99, Vår 2001 Frank Skorpen IKM, DMF

Regulering av DNA Transkripsjon i Eukaryote Organismer. ID, Kull 99, Vår 2001 Frank Skorpen IKM, DMF Regulering av DNA Transkripsjon i Eukaryote Organismer ID, Kull 99, Vår 2001 Frank Skorpen IKM, DMF 1 Regulering av gen-uttrykk på mange nivåer Klargjøring av DNA Transkripsjon Initiering Stopp hnrna prosessering


Kapittel 14: Det eukaryote genom og dets uttrykksregulering

Kapittel 14: Det eukaryote genom og dets uttrykksregulering Kapittel 14: Det eukaryote genom og dets uttrykksregulering Innhold: 1. Det humane genom 2. Struktur av protein-kodende gener 3. RNA processering 4. Transkripsjonell kontroll 5. Posttranskripsjonell kontroll





Sammenligningen mellom Arabidopsis thaliana genomet og de kjente genomene fra cyanobakterier, gjær, bananflue og nematode, viser bl. a.

Sammenligningen mellom Arabidopsis thaliana genomet og de kjente genomene fra cyanobakterier, gjær, bananflue og nematode, viser bl. a. Sammenligningen mellom Arabidopsis thaliana genomet og de kjente genomene fra cyanobakterier, gjær, bananflue og nematode, viser bl. a. Antall gener som er involvert i cellulær kommunikasjon og signaloverføring



Kapittel 12: FRA DNA TIL PROTEIN: Kapittel 12: FRA DNA TIL PROTEIN: fra genotype til fenotype 1. Gener og polypeptider 2. DNA, RNA og informasjonsflow 3. Transkripsjon: DNA-dirigert RNA-syntese 4. Den genetiske kode 5. Aktører i Translasjon


Flervalgsoppgaver: proteinsyntese

Flervalgsoppgaver: proteinsyntese Flervalgsoppgaver - proteinsyntese Hver oppgave har ett riktig svaralternativ. Proteinsyntese 1 Hva blir transkribert fra denne DNA sekvensen: 3'-C-C-G-A-A-T-G-T-C-5'? A) 3'-G-G-C-U-U-A-C-A-G-5' B) 3'-G-G-C-T-T-A-C-A-G-5'


Regulering av genuttrykk

Regulering av genuttrykk 1, stadium IC, 2012, Tonje S. Steigedal 2 Grunnlaget for regulering av cellens funksjoner ligger lagret i arvematerialet - i DNA- molekylet. For at genene skal utøve sin funksjon, må de imidlertid uttrykkes


Medisin stadium 1c Geir Slupphaug, IKM Regulering av genuttrykk

Medisin stadium 1c Geir Slupphaug, IKM Regulering av genuttrykk Medisin stadium 1c Geir Slupphaug, IKM Regulering av genuttrykk Grunnlaget for regulering av cellens funksjoner ligger lagret i arvematerialet - i DNA- molekylet For at genene skal utøve sin funksjon,


Bare et fåtall av genene uttrykkes i hver celle

Bare et fåtall av genene uttrykkes i hver celle 1 Medisin stadium 1c Geir Slupphaug, IKM Regulering av genuttrykk Grunnlaget for regulering av cellens funksjoner ligger lagret i arvematerialet - i DNA- molekylet For at genene skal utøve sin funksjon,


Foreleser: Eivind Coward, kontor 5. etg. Datablokken. Gruppeleder: Harald Barsnes

Foreleser: Eivind Coward, kontor 5. etg. Datablokken. Gruppeleder: Harald Barsnes Foreleser: Eivind Coward, kontor 5. etg. Datablokken. Gruppeleder: Harald Barsnes Forelesninger: tirsdag og fredag 12 14 rom 2104 Øvinger: fredag 10 12 rom 2143 Gi en innføring i noen


BI Celle- og molekylærbiologi

BI Celle- og molekylærbiologi BI1001 1 Celle- og molekylærbiologi Oppgaver Oppgavetype Vurdering Startside Dokument Automatisk poengsum 1 1a Skriveoppgave Manuell poengsum 2 1b Skriveoppgave Manuell poengsum 3 1c Skriveoppgave Manuell


Eksamensoppgave i BI1001 Celle og Molekylærbiologi

Eksamensoppgave i BI1001 Celle og Molekylærbiologi Institutt for Biologi Eksamensoppgave i BI1001 Celle og Molekylærbiologi Faglig kontakt under eksamen: Professor Berit Johansen Tlf.: 73598691 Eksamensdato: 30 november Eksamenstid (fra-til): 9-15 Hjelpemiddelkode/Tillatte


Forelesninger i BI Cellebiologi. Enzymer : senker aktiveringsenergien. Figure 6.13

Forelesninger i BI Cellebiologi. Enzymer : senker aktiveringsenergien. Figure 6.13 Enzymer : senker aktiveringsenergien Figure 6.13 Aktive seter : camp-avhengig protein kinase *For å illustrere hvordan det aktive setet binder et spesifikt substrat er valgt som eksempel camp-avhengig



EKSAMENSOPPGAVE I BI1001 CELLE- OG MOLEKYLÆRBIOLOGI Norges teknisk-naturvitenskapelige universitet Institutt for biologi EKSAMENSOPPGAVE I BI1001 CELLE- OG MOLEKYLÆRBIOLOGI Faglig kontakt under eksamen: Berit Johansen Tlf.: 91897000 Eksamensdato: 25. mai



EKSAMENSOPPGAVE I BI1001 CELLE- OG MOLEKYLÆRBIOLOGI Norges teknisk-naturvitenskapelige universitet Institutt for biologi KSAMNSOPPGAV I BI1001 CLL- OG MOLKYLÆRBIOLOGI Faglig kontakt under eksamen: Jens Rohloff Tlf.: 97608994 ksamensdato: 4. juni 2010 ksamenstid:


Medisin stadium 1A Geir Slupphaug, IKM. Den eukaryote cellen I

Medisin stadium 1A Geir Slupphaug, IKM. Den eukaryote cellen I Medisin stadium 1A Geir Slupphaug, IKM Den eukaryote cellen I Celler finnes i utallige varianter Prokaryote celler Prokaryote celler deles inn i archaebakterier og eubakterier. De er relativt små (1-5


Den eukaryote cellen I. Prokaryote celler

Den eukaryote cellen I. Prokaryote celler Medisin stadium 1A Geir Slupphaug, IKM Celler finnes i utallige varianter Den eukaryote cellen I Prokaryote celler deles inn i archaebakterier og eubakterier. De er relativt små (1-5 μm) og har en enkel


... Proteiner og enzymer. kofaktor. polypeptid

... Proteiner og enzymer. kofaktor. polypeptid 30 Proteiner og enzymer Proteiner er bygd opp av rekker av aminosyrer som er kveilet sammen ved hjelp av bindinger på kryss og tvers, såkalte peptidbindinger. Slike oppkveilete rekker av aminosyrer kaller





Kap 12. Det eukaryote kromosom. En organelle for pakking og styring av DNA

Kap 12. Det eukaryote kromosom. En organelle for pakking og styring av DNA Kap 12. Det eukaryote kromosom En organelle for pakking og styring av DNA Oversikt over kapittel 12 Komponentene i et kromosom: DNA, histoner, og nonhiston proteiner Ett langt DNA molekyl og mange typer


Introduksjon til Biokjemi. Ingar Leiros, Institutt for Kjemi, UiT

Introduksjon til Biokjemi. Ingar Leiros, Institutt for Kjemi, UiT Introduksjon til Biokjemi Ingar Leiros, Institutt for Kjemi, UiT Biokjemi Biokjemi (Wikipedia): -Studien av de kjemiske prosesser i levende organismer, eller sagt på en annen måte; det molekylære grunnlaget


EKSAMENSOPPGAVE I BI1001 Celle og molekylærbiologi

EKSAMENSOPPGAVE I BI1001 Celle og molekylærbiologi Norges teknisk-naturvitenskapelige universitet Institutt for Biologi Norwegian University of Science and Technology Department of Biology EKSAMENSOPPGAVE I BI1001 Celle og molekylærbiologi - Faglig kontakt


FYS 3710 Biofysikk og Medisinsk Fysikk, DNA, RNA, Translasjon, Transkripsjon Proteinsyntese, Cellesyklus

FYS 3710 Biofysikk og Medisinsk Fysikk, DNA, RNA, Translasjon, Transkripsjon Proteinsyntese, Cellesyklus FYS 3710 Biofysikk og Medisinsk Fysikk, 2017 7 DNA, RNA, Translasjon, Transkripsjon Proteinsyntese, Cellesyklus Einar Sagstuen, Fysisk institutt, UiO 18.09.2017 1 DNA A / C / G / T 2 -deoxyribose monofosfate


BI Celle- og molekylærbiologi

BI Celle- og molekylærbiologi BI1001 1 Celle- og molekylærbiologi Oppgaver Oppgavetype Vurdering Startside Dokument Automatisk poengsum 1 Oppgave 1 Skriveoppgave Manuell poengsum 2 Oppgave 2a Skriveoppgave Manuell poengsum 3 Oppgave


Den komplette DNA sekvens fra en organisme.

Den komplette DNA sekvens fra en organisme. Definisjoner: Hva er et genom? Den komplette DNA sekvens fra en organisme. Den komplette samlingen av gener som koder for alle proteiner, pluss ribosomalt RNA, trna, snrna (involvert i mrna spleising)


1. En ikke-naturlig forekommende eller konstruert sammensetning omfattende:

1. En ikke-naturlig forekommende eller konstruert sammensetning omfattende: 1 Patentkrav EP2931898 1. En ikke-naturlig forekommende eller konstruert sammensetning omfattende: et leveringssystem som er operativt konfigurert for å levere CRISPR-Caskomplekskomponenter eller polynukleotidsekvenser


Oppgave 2b V1979 Hvor i cellen foregår proteinsyntesen, og hvordan virker DNA og RNA i cellen under proteinsyntesen?

Oppgave 2b V1979 Hvor i cellen foregår proteinsyntesen, og hvordan virker DNA og RNA i cellen under proteinsyntesen? Bi2 «Genetikk» [3B] Målet for opplæringa er at elevane skal kunne gjere greie for transkripsjon og translasjon av gen og forklare korleis regulering av gen kan styre biologiske prosessar. Oppgave 2b V1979


Epigenetikk; arvesynden i ny innpakning? Dag O. Hessen University of Oslo, Dept. Biology Center of Ecological and Evolutionary Synthesis (CEES)

Epigenetikk; arvesynden i ny innpakning? Dag O. Hessen University of Oslo, Dept. Biology Center of Ecological and Evolutionary Synthesis (CEES) Epigenetikk; arvesynden i ny innpakning? Dag O. Hessen University of Oslo, Dept. Biology Center of Ecological and Evolutionary Synthesis (CEES) Den genetiske kode Oppnøstingen av den genetiske kode foregikk


DNA - kroppens byggestener

DNA - kroppens byggestener DNA - kroppens byggestener Nina Baltzersen 22. september 2011 Enten man har slått seg, er forkjølet, støl etter trening eller rett og slett bare har en vanlig dag, så arbeider kroppen for fullt med å reparere


DNA-replikasjon. Dannelse av primere og Okazaki-fragment Koordinering av DNA-syntesen i leading og lagging strand

DNA-replikasjon. Dannelse av primere og Okazaki-fragment Koordinering av DNA-syntesen i leading og lagging strand DNA-replikasjon, 1C Geir Slupphaug, IKM DNA-replikasjon Vil bli gjennomgått: Hovedvekt på prosesser i eukaryote celler Initiering av replikasjonen Dannelse av primere og Okazaki-fragment Koordinering av


Genkartlegging. Hva er egentlig et genkart? Genetisk og fysisk kartlegging

Genkartlegging. Hva er egentlig et genkart? Genetisk og fysisk kartlegging NTNU Genkartlegging 1 Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer Hva er egentlig et genkart? Kartet over det humane genom gir oss posisjonen av de ca 25,000 genene


Født sånn eller blitt sånn: om gener, søppel-dna og epigenetikk

Født sånn eller blitt sånn: om gener, søppel-dna og epigenetikk Født sånn eller blitt sånn: om gener, søppel-dna og epigenetikk Dag O. Hessen University of Oslo, Dept. Biology Center of Ecological and Evolutionary Synthesis (CEES) Kappløpet et (kort) historisk tilbakeblikk



GENETISKE MEKANISMER INVOLVERT I SPREDING AV RESISTENS GENETISKE MEKANISMER INVOLVERT I SPREDING AV RESISTENS KRISTIN HEGSTAD OUTLINE Hvordan erverves nye egenskaper? Mekanismer for horisontal genoverføring (HGT) Genetiske elementer involvert i spredning Definisjoner


Frå DNA til Protein. Medisin stadium IA, 9. september Astrid Lægreid

Frå DNA til Protein. Medisin stadium IA, 9. september Astrid Lægreid Frå DNA til Protein Medisin stadium IA, 9. september 2016 Astrid Lægreid Celler inneheld DNA arvematerialet i dei fleste levande system Genomet er organismen sitt komplette sett


Institutt for biologi Faglig kontaktperson under eksamen: Berit Johansen, 98691. EKSAMEN I: BI1001 Celle- og molekylærbiologi BOKMÅL

Institutt for biologi Faglig kontaktperson under eksamen: Berit Johansen, 98691. EKSAMEN I: BI1001 Celle- og molekylærbiologi BOKMÅL Side 1 av 5 Norges teknisknaturvitenskapelige universitet Fakultet for naturvitenskap og teknologi Institutt for biologi Faglig kontaktperson under eksamen: Berit Johansen, 98691 EKSAMEN I: BI1001 Celle-


Kapittel 20, introduksjon

Kapittel 20, introduksjon Kapittel 20, introduksjon Ekstracellulær signalisering Syntese Frigjøring Transport Forandring av cellulær metabolisme, funksjon, utvikling (trigga av reseptor-signal komplekset) Fjerning av signalet Signalisering



EKSAMENSOPPGAVE I BI1001 CELLE- OG MOLEKYLÆRBIOLOGI Norges teknisk-naturvitenskapelige universitet Institutt for biologi EKSAMENSOPPGAVE I BI1001 CELLE- OG MOLEKYLÆRBIOLOGI Faglig kontakt under eksamen: Jens Rohloff Tlf.: 976 08 994 - Eksamensdato: 29.5.2008


Bioteknologi i dag muligheter for fremtiden

Bioteknologi i dag muligheter for fremtiden Bioteknologi i dag muligheter for fremtiden Arvestoff Genetisk materiale, DNA. Baser En del av et nukleotid som betegnes med bokstavene A, C, G og T. Med disse fire bokstavene skriver DNAtrådene sine beskjeder



EKSAMENSOPPGAVE I BI1001 CELLE- OG MOLEKYLÆRBIOLOGI Norges teknisk-naturvitenskapelige universitet Institutt for biologi EKSAMENSOPPGAVE I BI1001 CELLE- OG MOLEKYLÆRBIOLOGI Faglig kontakt under eksamen: Berit Johansen Tlf.: 91897000 Eksamensdato: 04. desember


Cellebiologiske prosesser som respons på virusinfeksjon

Cellebiologiske prosesser som respons på virusinfeksjon Cellebiologiske prosesser som respons på virusinfeksjon PBM 336 2005 Siri Mjaaland Infeksjoner - immunresponser 1 Figure 2-49 Interferoner Uspesifikk immunitet viral infeksjon stimulerer direkte produksjon


FYS3710 Molekylærbiologi

FYS3710 Molekylærbiologi 1 2 I en eukaryot celle er kromosomene festet i en indre membran som omgir en kjerne. Proteinene produseres i cellens cytoplasma. 3 I en prokaryot celle (for eksempel en bakteriecelle) er det ett kromosom.


PBM 233 Mikrobiologi for farmasøyter

PBM 233 Mikrobiologi for farmasøyter PBM 233 Mikrobiologi for farmasøyter Faglærer 2004: Per Arne Risøen Biologisk seksjon, ZEB Kap. 11 Mikrobiell evolusjon og systematikk Dateringer av fossiler viser at bakterier oppstod for ca. 3,6 milliarder


Oppgave: MED1100-3_OPPGAVE2_H16_KONT

Oppgave: MED1100-3_OPPGAVE2_H16_KONT Side 10 av 35 Oppgave: MED1100-3_OPPGAVE2_H16_KONT Del 1: Ola har en arvelig betinget kombinert immundefekt med mangel på både T-celler og B-celler. Ola får derfor gjentatte Hvorfor er Ola beskyttet mot



FAKULTET FOR TEKNOLOGI OG REALFAG EKSAMEN g UNIVERSITETET I AGDER FAKULTET FOR TEKNOLOGI OG REALFAG EKSAMEN Emnekode: BI0105 Emnenavn: Genetikk og evolusjon Dato: 7. mai 2012 Varighet: 4 timer Antall sider inkl. forside 8 Tillatte hjelpemidler:


Cellesignalisering II: Reseptor tyrosin kinaser, cytosoliske kinaser

Cellesignalisering II: Reseptor tyrosin kinaser, cytosoliske kinaser Cellesignalisering II: Reseptor tyrosin kinaser, cytosoliske kinaser! Introduksjon! Definisjon og klassifisering! Kinasefamilier: Receptor/cytosol! Receptor Tyrosin kinase-mediert signalisering! MAP kinase



EKSAMEN I BI1001 CELLE OG MOLEKYLÆRBIOLOGI Fag/ Emnekode: BI1001 Dato: Kandidatnr.: Norges Teknisk Naturvitenskapelige Universitet Institutt for Biologi EKSAMEN I BI1001 CELLE OG MOLEKYLÆRBIOLOGI Ansvarlig kontakt ved eksamen: Berit Johansen Phone:



EKSAMENSOPPGAVE I BI1001 CELLE- OG MOLEKYLÆRBIOLOGI Norges teknisk-naturvitenskapelige universitet Institutt for biologi EKSAMENSOPPGAVE I BI1001 CELLE- OG MOLEKYLÆRBIOLOGI Faglig kontakt under eksamen: Berit Johansen Tlf.: 91897000 Eksamensdato: 19. mai


Hovedområde: Bioteknologi Eksamensoppgaver fra skriftlig eksamen Naturfag (NAT1002).

Hovedområde: Bioteknologi Eksamensoppgaver fra skriftlig eksamen Naturfag (NAT1002). Hovedområde: Bioteknologi Eksamensoppgaver fra skriftlig eksamen Naturfag (NAT1002). Oppgave 26 V2008 Et eksempel på godkjent bruk av bioteknologi i Norge er A) gentesting for arvelige sykdommer B) genterapi


DNA-replikasjon. DNA-replikasjon. Viktige punkt (repetisjon) Replikasjon foregår i replikasjonsfabrikker. Vil bli gjennomgått: I løpet av cellens

DNA-replikasjon. DNA-replikasjon. Viktige punkt (repetisjon) Replikasjon foregår i replikasjonsfabrikker. Vil bli gjennomgått: I løpet av cellens , 1C/D Geir Slupphaug, IKM Vil bli gjennomgått: Hovedvekt på prosesser i eukaryote celler Initiering av replikasjonen I løpet av cellens livssyklus, må DNAinnholdet i cellekjernen fordobles G0 G1 Dannelse



UNIVERSITETET I OSLO UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Eksamen i MBV 1030 Generell biokjemi Eksamensdag: Mandag 6. desember 2004 Tid for eksamen: kl. 09.00 12.00 Oppgavesettet er på 9 sider Vedlegg:


Reproduksjon av dyrevirus. Adsorpsjon Penetrasjon og avkledning Replikasjon og transkripsjon Syntese og samling (assembly) av viruskapsid Frigjøring

Reproduksjon av dyrevirus. Adsorpsjon Penetrasjon og avkledning Replikasjon og transkripsjon Syntese og samling (assembly) av viruskapsid Frigjøring Reproduksjon av dyrevirus Adsorpsjon Penetrasjon og avkledning Replikasjon og transkripsjon Syntese og samling (assembly) av viruskapsid Frigjøring ATTACHMENT Click after each step to view process PENETRATION


Fasit til oppgavene. K-skallet L-skallet M-skallet

Fasit til oppgavene. K-skallet L-skallet M-skallet Kapittel 1 1. Tegn atomet til grunnstoffet svovel (S), og få med antall protoner, nøytroner, elektroner, elektronskall og antall valenselektroner. K-skallet L-skallet M-skallet Svovel har, som vi kan se



FLERVALGSOPPGAVER I NATURFAG FLERVALGSOPPGAVER I NATURFAG BIOLOGI Naturfag biologi 1 Hva er IKKE riktig om nitrogenforbindelser? A) Alle dyr må spise mat som inneholder nitrogenforbindelser. B) Noen dyr kan utnytte N 2 fra luften.


Oversikt over kap. 11. Kap. 11 Den direkte påvisning av genotype skiller individuelle genomer. Fire klasser av DNA polymorfismer.

Oversikt over kap. 11. Kap. 11 Den direkte påvisning av genotype skiller individuelle genomer. Fire klasser av DNA polymorfismer. Kap. 11 Den direkte påvisning av genotype skiller individuelle genomer Oversikt over kap. 11 Fire klasser av DNA variasjon til direkte påvisning av genotype. Metoder som bruker hybridisering, elektroforese,


DNA-replikasjon. DNA-replikasjon. Viktige punkt (repetisjon) Replikasjon foregår i replikasjonsfabrikker. Vil bli gjennomgått: I løpet av cellens

DNA-replikasjon. DNA-replikasjon. Viktige punkt (repetisjon) Replikasjon foregår i replikasjonsfabrikker. Vil bli gjennomgått: I løpet av cellens , 1C Geir Slupphaug, IKM Vil bli gjennomgått: Hovedvekt på prosesser i eukaryote celler I løpet av cellens livssyklus, må DNAinnholdet i cellekjernen fordobles G0 G1 Initiering av replikasjonen Dannelse


Cellesyklus. Medisin stadium IA, 17. september 2012

Cellesyklus. Medisin stadium IA, 17. september 2012 Cellesyklus Medisin stadium IA, 17. september 2012 Trude Helen Flo Cellesyklus: En oversikt Definisjoner De ulike fasene av cellesyklus Regulering av cellesyklus Kort om apoptose Kort om stamceller Cellesyklus:


Oversikt over kap.10. Kap 10. Rekonstruksjon av Genomet. Splitt og overvinn strategien imøtekommer de fleste utfordringer

Oversikt over kap.10. Kap 10. Rekonstruksjon av Genomet. Splitt og overvinn strategien imøtekommer de fleste utfordringer Kap 10. Rekonstruksjon av Genomet Gjennom genetisk og molekylær analyse Oversikt over kap.10 Utfordringer og strategier ved genomanalyse Genomstørrelse Egenskaper må også analyseres Problemer med DNA polymorfismer


T celle aktivering og HLA Trond S. S. Halstensen

T celle aktivering og HLA Trond S. S. Halstensen T celle aktivering og HLA Trond S. S. Halstensen T-celler og Thymus T cellens identifisering av antigener Human Leukocyt Antigen (HLA) restriksjon, CD4 og CD8 Antigen prosessering: cytosol- og endocytisk


Ulike former for DNA-replikasjon. DNA er selv templat for replikasjon. Meselson og Stahls eksperiment (1958) I løpet av cellens

Ulike former for DNA-replikasjon. DNA er selv templat for replikasjon. Meselson og Stahls eksperiment (1958) I løpet av cellens DNA-replikasjon Ulike former for DNA-replikasjon I løpet av cellens livssyklus, må DNAinnholdet i cellekjernen fordobles Dette skjer i S- (syntese-) fasen i cellesyklus. Selve prosessen kalles DNA-replikasjon


Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling?

Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling? Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling? Hege G. Russnes Forsker ved Avd. For Genetikk, Institutt for Kreftforskning og overlege ved Avd. For Patologi Oslo Universitetssykehus



UNIVERSITETET I AGDER FAKULTET FOR TEKNOLOGI OG REALFAG EKSAMEN Emnekode: BI0105 Emnenavn: Genetikk og evolusjon Dato: 21. november 2011 Varighet: 2 timer Antall sider inkl. forside 8 Tillatte hjelpemidler: Kalkulator Merknader:


Hvor er genene? Gensøk-algoritmer. Gener i prokaryoter. Genenes anatomi (prokaryoter) Forelesning INF3350/4350 5. sept 2007

Hvor er genene? Gensøk-algoritmer. Gener i prokaryoter. Genenes anatomi (prokaryoter) Forelesning INF3350/4350 5. sept 2007 Gensøk-algoritmer Hvor er genene? Forelesning INF330/430. sept 2007 Ole Christian Lingjærde Gruppen for bioinformatikk Institutt for Informatikk, UiO En viktig del av kartleggingen av et genom er å finne


Forløp av ikke-adaptiv og adaptiv immunrespons. Mononukleære celler, metylfiolett farging

Forløp av ikke-adaptiv og adaptiv immunrespons. Mononukleære celler, metylfiolett farging Forløp av ikke-adaptiv og adaptiv immunrespons Mononukleære celler, metylfiolett farging 1 Nøytrofile granulocytter Gjenkjennelsesprinsipper medfødt vs. adaptiv immunitet Toll Like Receptors Mikroorganismer


Kokeboka, oppskriften og kirsebærpaien

Kokeboka, oppskriften og kirsebærpaien Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Farefull spleising - en ny måte å tenke om det skadelige huntingtinproteinet Forskere


DNA replikasjon. Hovedvekt på prosesser i eukaryote celler. Dannelse av primere og Okazaki-fragment

DNA replikasjon. Hovedvekt på prosesser i eukaryote celler. Dannelse av primere og Okazaki-fragment 1 DNA replikasjon, Stadium IC, 2012, Tonje Strømmen Steigedal 2 Vil bli gjennomgått: Hovedvekt på prosesser i eukaryote celler Initiering av replikasjonen Dannelse av primere og Okazaki-fragment Koordinering


FYS 3710 Biofysikk og Medisinsk Fysikk, Aminosyrer, Polypeptider, Proteiner

FYS 3710 Biofysikk og Medisinsk Fysikk, Aminosyrer, Polypeptider, Proteiner FYS 3710 Biofysikk og Medisinsk Fysikk, 2016 5 Aminosyrer, Polypeptider, Proteiner Einar Sagstuen, Fysisk institutt, UiO 06.09.2016 1 sp n -hybridisering: for hovedkvantetall N=2 er de fire valensorbitalene


HIV / AIDS -infeksjon - behandling

HIV / AIDS -infeksjon - behandling HIV / AIDS -infeksjon - behandling HIV / AIDS 1981 første gang anerkjent som distinkt sykdom Opprinnelig overført fra sjimpanse Viruset kan ha sirkulert fra 1915-1941 Trolig sirkulert blant populasjoner



UNIVERSITETET I OSLO UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Eksamen i : INF2300 Grunnkurs i bioinformatikk Eksamensdag : Tirsdag 15. juni 2004 Tid for eksamen : 09.00 12.00 Oppgavesettet er på : 13


Mennesket og mikrobene. Elling Ulvestad Mikrobiologisk avdeling, Haukeland Universitetssykehus Klinisk institutt 2, Universitetet i Bergen

Mennesket og mikrobene. Elling Ulvestad Mikrobiologisk avdeling, Haukeland Universitetssykehus Klinisk institutt 2, Universitetet i Bergen Mennesket og mikrobene Elling Ulvestad Mikrobiologisk avdeling, Haukeland Universitetssykehus Klinisk institutt 2, Universitetet i Bergen Bakteppe Hvordan handle slik situasjonen krever av oss? Hvordan


Kapittel 16 Utvikling: differensielt genuttrykk

Kapittel 16 Utvikling: differensielt genuttrykk Kapittel 16 Utvikling: differensielt genuttrykk 1. Utvikling 2. Differensielt genuttrykks rolle i celledifferensiering 3. Polaritets rolle i cellebestemmelse 4. Embryonisk induksjon i cellebestemmelse


Klinisk molekylærmedisin (5): Eksempler på funksjonelle analyser

Klinisk molekylærmedisin (5): Eksempler på funksjonelle analyser Pediatrisk Endokrinologi 2003;17: 64-69 Klinisk molekylærmedisin (5): Eksempler på funksjonelle analyser Pål Rasmus Njølstad 1,2,3, Lise Bjørkhaug 1 1 Seksjon for pediatri, Institutt for klinisk medisin


BIOS 2 Biologi... 2...

BIOS 2 Biologi... 2... . BI 2 Biologi..... 2..................................... Figurer kapittel 5: D er arvestoffet Figur s. 132 kromosom D-tråd ett gen vert D-molekyl inneholder mange gener, og et gen er den Figur delen



UNIVERSITETET I OSLO UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Eksamen i : INF2300 Grunnkurs i bioinformatikk Eksamensdag : Mandag 6. juni 2005 Tid for eksamen : 09.00 12.00 Oppgavesettet er på : xx


Klipp og lim: Genredigering med CRISPR teknologi

Klipp og lim: Genredigering med CRISPR teknologi Klipp og lim: Genredigering med CRISPR teknologi Realfagskonferanse 4. mai 2017 Magnar Bjørås Institutt for kreftforskning og molekylærmedisin, NTNU Klinikk for laboratoriemedisin, Oslo Universitetssykehus


Flervalgsoppgaver: Arvestoffet

Flervalgsoppgaver: Arvestoffet Flervalgsoppgaver - Arvestoffet ver oppgave har ett riktig svaralternativ Arvestoffet 1 va er komponentene i et DNA-nukleotid? A) et par komplementære baser B) en dobbelthelix som holdes sammen av hydrogenbindinger


Avhengighet og gener - et evolusjonært perspektiv

Avhengighet og gener - et evolusjonært perspektiv Avhengighet og gener - et evolusjonært perspektiv Dag O. Hessen University of Oslo, Dept. Biology Center of Ecological and Evolutionary Synthesis (CEES) Det sentrale spørsmål Er vår adferd og preferanser


EKSAMEN I EMNE TBT4102 BIOKJEMI I. 2. desember 2011 kl

EKSAMEN I EMNE TBT4102 BIOKJEMI I. 2. desember 2011 kl NORGES TEKNISK-NATURVITENSKAPELIGE UNIVERSITET INSTITUTT FOR BIOTEKNOLOGI Faglig kontakt under eksamen: Institutt for bioteknologi, Gløshaugen Hanne Jørgensen, tlf. 591685 EKSAMEN I EMNE TBT4102 BIOKJEMI



LEHNINGER PRINCIPLES OF BIOCHEMISTRY David L. Nelson and Michael M. Cox LEHNINGER PRINCIPLES OF BIOCHEMISTRY Fifth Edition CHAPTER 19 Oxidative Phosphorylation 2008 W. H. Freeman and Company Cellulær respirasjon: siste trinn Elektronoverføring


INF280 Søking og maskinlæring

INF280 Søking og maskinlæring INF280 Søking og maskinlæring Foreleser: Eivind Coward, kontor 5. etg. Datablokken. Gruppeleder: Harald Barsnes Forelesninger: tirsdag og fredag 12 14 rom 2104 Øvinger: fredag 10 12 rom


Reproduksjon av dyrevirus. Adsorpsjon Penetrasjon og avkledning Replikasjon og transkripsjon Syntese og samling (assembly) av viruskapsid Frigjøring

Reproduksjon av dyrevirus. Adsorpsjon Penetrasjon og avkledning Replikasjon og transkripsjon Syntese og samling (assembly) av viruskapsid Frigjøring Reproduksjon av dyrevirus Adsorpsjon Penetrasjon og avkledning Replikasjon og transkripsjon Syntese og samling (assembly) av viruskapsid Frigjøring ATTACHMENT Click after each step to view process PENETRATION





Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser

Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser PEDENDO_SISTE_slutt.qxd 18.12.2003 21:34 Side 32 Pediatrisk Endokrinologi 2003;17: 34-38 Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser Pål Rasmus Njølstad 1,2,3,Jørn V. Sagen


Hva er bioinformatikk? Introduksjon til bioinformatikk. Summary. Menneskets genom. Prokaryoter og eukaryoter. Lars O. Baumbusch

Hva er bioinformatikk? Introduksjon til bioinformatikk. Summary. Menneskets genom. Prokaryoter og eukaryoter. Lars O. Baumbusch Introduksjon til bioinformatikk Summary Hva er bioinformatikk? Bruk av informatikk og statistikk til å trekke biologisk forståelse ut av molekylære data fra levende organismer Lars O. Baumbusch Senter


Oncogenic Mutations Affecting Cell Proliferation

Oncogenic Mutations Affecting Cell Proliferation Oncogenic Mutations Affecting Cell Proliferation Fra RTK til Nucleus (Boka s.1070-74) Normalt kreves et vekst stimulerende signal ( growth factor eks. PDGF, EGF, NGF) for at celler skal gå inn i celledeling,


Epigenetikk: 2 Fosterhjemskontakt 2/17. Om forfatterene

Epigenetikk: 2 Fosterhjemskontakt 2/17. Om forfatterene Alt Epigenetikk: er ikke bare g Om forfatterene Anette S. B Wolff (PhD) tok dr.graden ved Universitetet i Bergen i 2005 og har siden jobbet som forsker ved det samme universitetet. Bergithe Eikeland Oftedal


UNIVERSITETET I OSLO. Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO. Det matematisk-naturvitenskapelige fakultet UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Eksamen i MBV 1030 Generell biokjemi Eksamensdag: 6. /7. januar 2005 Tid for eksamen: Oppgavesettet er på 6 sider Vedlegg: 1 Tillatte hjelpemidler:



UNIVERSITETET I OSLO Bokmål UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Eksamen i : INF2300 Grunnkurs i bioinformatikk Eksamensdag : Mandag 6. juni 2005 Tid for eksamen : 09.00 12.00 Oppgavesettet er på


Repetisjonsark til vurdering i naturfag Celler og arv. Kap.1 Celler og arv Kjenneteikn på levande organismar S. 7-8

Repetisjonsark til vurdering i naturfag Celler og arv. Kap.1 Celler og arv Kjenneteikn på levande organismar S. 7-8 Repetisjonsark til vurdering i naturfag Celler og arv Læringsmål: Forklare kva som kjenneteiknar levande organismar Kunne skildre oppbygginga av dyre- og planteceller Forklare hovudtrekka i fotosyntese


Så, hvordan lager man nye nerveceller?

Så, hvordan lager man nye nerveceller? Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Å omdanne hudceller til hjerneceller: et gjennombrudd innen forskning på Huntingtons



FLERVALGSOPPGAVER GENETIKK FLERVALGSOPPGAVER GENETIKK FLERVALGSOPPGAVER FRA EKSAMEN I BIOLOGI 2 Disse flervalgsoppgavene er hentet fra eksamen i Biologi 2 del 1. Det er fire (eller fem) svaralternativer i hver oppgave, og bare ett


Eksamensoppgave i PSY3111 Individuell utvikling, gener, nervesystem og atferd

Eksamensoppgave i PSY3111 Individuell utvikling, gener, nervesystem og atferd Psykologisk institutt Eksamensoppgave i PSY3111 Individuell utvikling, gener, nervesystem og atferd Faglig kontakt under eksamen: Dawn Behne Tlf.: Psykologisk institutt 73 59 19 60 Eksamensdato: 18.12.2014


Forelesninger i BI Cellebiologi. Protein struktur og funksjon - Kap. 3

Forelesninger i BI Cellebiologi. Protein struktur og funksjon - Kap. 3 Forelesninger i BI 212 - Cellebiologi Protein struktur og funksjon - Kap. 3 Tor-Henning Iversen, Plantebiosenteret (PBS),Botanisk institutt,ntnu e-mail : Tlf. 73 59


Hvor er responsen når vi ikke bruker den? Tore Vignes og Stein Evensen

Hvor er responsen når vi ikke bruker den? Tore Vignes og Stein Evensen Hvor er responsen når vi ikke bruker den? Tore Vignes og Stein Evensen Responser Noen bruker vi hele tiden Noen bruker vi sjelden Noen har vi nesten ikke brukt! Where is the f.. response!? Klasser Funksjonelle


Examination paper for Bi2014 Molecular Biology

Examination paper for Bi2014 Molecular Biology Department of Biology Examination paper for Bi2014 Molecular Biology Academic contact during examination: Professor Atle M. Bones Phone: 91897237 (73598692) Examination date/eksamensdag: 7. December 2016


Faglig kontaktperson under eksamen: Jens Rohloff (mob 97608994)

Faglig kontaktperson under eksamen: Jens Rohloff (mob 97608994) Side 1 av 6 Norges teknisknaturvitenskapelige universitet Fakultet for naturvitenskap og teknologi Institutt for biologi Faglig kontaktperson under eksamen: Jens Rohloff (mob 97608994) EKSAMEN I: BI1001



GENTEKNOLOGISK ARBEID MED NAKENT DNA Sosial- og helsedepartementet Pb 8011 Dep. 0030 OSLO Oslo, 2. mai 1996. Ref. 96/00015-003RKA/401 GENTEKNOLOGISK ARBEID MED NAKENT DNA Det vises til brev fra Sosial- og helsedepartementet datert 6. februar


Institutt for biologi Faglig kontaktperson under eksamen: Berit Johansen (91897000) EKSAMEN I: BI1001 Celle- og molekylærbiologi BOKMÅL

Institutt for biologi Faglig kontaktperson under eksamen: Berit Johansen (91897000) EKSAMEN I: BI1001 Celle- og molekylærbiologi BOKMÅL 1 av 7 Norges teknisknaturvitenskapelige universitet Fakultet for naturvitenskap og teknologi Institutt for biologi Faglig kontaktperson under eksamen: Berit Johansen (91897000) EKSAMEN I: BI1001 Celle-


Amplifikasjonsteknikker - andre metoder

Amplifikasjonsteknikker - andre metoder Amplifikasjonsteknikker - andre metoder Svein Arne Nordbø TH-28973 17.03.15 Alternative amplifikasjonsmetoder Templat-amplifikasjons metoder Signal-amplifikasjonsmetoder Templat-amplifikasjons metoder


Hfr-stammer Kartlegging ved avbrutt konjugasjon (time of entry)

Hfr-stammer Kartlegging ved avbrutt konjugasjon (time of entry) BAKTERIE OG FAG GENETIKK Man studerer ofte E. coli fordi den inneholder få gener (4700 kb)sammenlihgnet med menneskets ca 6 mill kb, har kort generasjonstid (20 min) og er hele livssyklusen i haploid tilstand.
