Nomenklatur, tolkning og klassifisering av sekvensvarianter NPU-kodeverket

Save this PDF as:

Størrelse: px
Begynne med side:

Download "Nomenklatur, tolkning og klassifisering av sekvensvarianter NPU-kodeverket"


1 Nomenklatur, tolkning og klassifisering av sekvensvarianter NPU-kodeverket Bjørn Ivar Haukanes (Haukeland) Liss Anne Solberg Lavik (St. Olav) Hilde Monica Stensland/Torill Fagerheim (UNN) Kristian Tveten (Telemark) Helge Rootwelt (MB-OUS) Mari Ann Kulseth (EEG-OUS) Lars Retterstøl (OUS) Torunn Fiskerstrand (Haukeland) Nomenklatur/variant vurdering NPU kodeverket

2 Nomenklatur Klassifiseringssystemet Bruk av frekvensdata Huskeliste for variantvurdering Klasse 2 Klasse 3 (VUS) Rapportering Videre utredning Klasse 4 Klasse 5 HTS og variantvurdering Fremtiden i genetisk diagnostiske labber

3 Nomenklatur GUIDELINES FOR GENE NOMENCLATURE HGNC - Guidelines for human gene nomenclature GUIDELINES FOR MUTATION NOMENCLATURE HGVS - Nomenclature for the description of sequence variations

4 HGVS Nomenklatur ( c.1 a ctaatcgtcagtgcagtacgtatgcgtcgagggcgtctgctggagatcgccctggga MetArgArgGlyArgLeuLeuGluIleAlaLeuGly p.1 tttaccgtgcttttagcgtcctacacgagccatggggcggacgccaatt PheThrValLeuLeuAlaSerTyrThrSerHisGlyAlaAspAlaAsn RefSeqID: NM_ Resultat: Heterozygot c.31c>a i FBN1 (NM_ ) NM_ (FBN1): c.[31c>a];[=] NM_ (FBN1): c.31c>a p.(leu11met)

5 HGVS nomenklatur versus «eldre» nomenklatur c.1 a ctaatcgtcagtgcagtacgtatgcgtcgagggcgtctgctggagatcgccctggga MetArgArgGlyArgLeuLeuGluIleAlaLeuGly «start»på mrna Nukleotid nr 1 p.1 tttaccgtgcttttagcgtcctacacgagccatggggcggacgccaatt PheThrValLeuLeuAlaSerTyrThrSerHisGlyAlaAspAlaAsn Modent protein aminosyre nr 1 Bruk HGVS nomenklatur, men inkluder i svarrapporten «eldre» nomenklatur

6 Transkript ID (Ref Seq) + variant = forståelig Unngå bruk av ekson nummer i svaret! Eventuelt benytt systematisk nummerering og angi tellemåte i svaret.

7 Nonsens varianter X * Ter HGVS: The three-letter amino acid code is preferred, with "Ter" or "*" designating a translation termination codon.

8 Bruk HGVS nomenklatur Inkluder RefSeqID i svarrapporten Vær forsiktig ved bruk av ekson nummer Bruk tre-bokstav-koden på aminosyrer Bruk «*» eller «Ter» for nonsensvarianter

9 Mutasjon versus sekvensvariant HGVS: Mutation and polymorphism In some disciplines the term "mutation" is used to indicate "a change" while in other disciplines it is used to indicate "a disease-causing change". Similarly, the term "polymorphism" is used both to indicate "a non disease-causing change" or "a change found at a frequency of 1% or higher in the population". To prevent this confusion we do not use the terms mutation and polymorphism (including SNP or Single Nucleotide Polymorphism) but use neutral terms like "sequence variant", "alteration" and "allelic variant". Haukeland: Bruker «mutasjon» så lenge Gunnar er sjefen!!!

10 Klassifisering av varianter 1) Normalvariant 2) Sannsynlig normalvariant 3) Usikker variant (VUS) 4) Sannsynlig patogen variant 5) Patogen variant

11 Carrier Testing for Severe Childhood Recessive Diseases by Next-Generation Sequencing. Bell et al., 2011 Sci Transl Med. 3; 65ra4 Bærertesting for 448 alvorlige pediatriske recessive sykdommer I 104 urelaterte DNA prøver ble det funnet en gjennomsnittlig bærerstatus på 2.8 sykdomsgivende varianter (0 til 7) (totalt 406). 27% av variantene som var angitt som sykdomsgivende i litteraturen, ble funnet å være normalvarianter eller å være feil annotert. «Severe, orphan disease mutations should be uncommon (<1% incidence) and should not be found in the homozygous state in unaffected individuals. Unexpectedly, we found that 74% of disease mutation calls were accounted for by substitutions with incidences of 5%, of which almost one-half were homozygous in samples unaffected by the corresponding disease. Also unexpected was the finding that 14 of 113 literature annotated disease mutations were incorrect. Thus, for many recessive diseases, HGMD, dbsnp, OMIM, and the literature are insufficient arbiters of whether variants are disease mutations»

12 Arvegang Prevalens Bærerfrekvens Frekvens Ekspressivitet Fenotype Sykdomsdebut Penetrans

13 Den ideelle kontrollpopulasjonen Ikke samme fenotype som pasienten Samme etnisitet, geografisk tilhørighet som pasienten Ved X-bundet arvegang er kjønn viktig For sykdommer med sein debut bør kontrollgruppen være eldre enn forventet debut alder Tilstrekkelig antall

14 Følgende kilder kan benyttes til å finne frekvensen i den generelle befolkningen: 1000Genome Phase 1: represents low coverage and exome data analysis available for the first 1092 samples. Available on ( ) (AlaMut) Phase 3: 2535 individuals from 26 different populations around the world. Available in a ftp file for downloading. NHLBI Exome Sequencing Project (ESP) EA og 2203 AA ( Bør benyttes med forsiktighet for hjerterelaterte sykdommer og cystisk fibrose CSAgilent The ClinSeq Project Biesecker LG et al., 2009 Ca 660 individuals available at Goal is 1500 participants dbsnp Med unntak av CSAgilent og ESP er populasjonene i dbsnp små og ikke alle representerer friske kontroller

15 Evolution and Functional Impact of Rare Coding Variation from Deep Sequencing of Human Exomes. (ESP) Tennessen JA et al., 2012 Science 337; 64


17 Bedre frekvensdata i fremtiden Exome Aggregation Consortium (ExAC), Cambridge, MA. Sequence of unrelated individuals "We have removed individuals affected by severe pediatric disease, so this data set should serve as a useful reference set of allele frequencies for severe disease studies. The genome project UK (planlagt ferdig i 2017) kontroller HUNT Nasjonale databaser!!

18 COL5A2 c.2011c>t rs i esp-ea 5 i 1000genome Population Allele Count Allele Number European (Finnish) Number of Homozygotes Allele Frequency Other European (Non-Finnish) Exome Aggregation Consortium African East Asian Latino South Asian Total

19 Bedre frekvensdata i fremtiden Exome Aggregation Consortium (ExAC), Cambridge, MA. Sequence of unrelated individuals "We have removed individuals affected by severe pediatric disease, so this data set should serve as a useful reference set of allele frequencies for severe disease studies. The genome project UK (planlagt ferdig i 2017) kontroller HUNT Nasjonale databaser!! Sjeldne varianter er vanlige

20 Evolution and Functional Impact of Rare Coding Variation from Deep Sequencing of Human Exomes. Tennessen JA et al., 2012 Science 337; 64

21 Nasjonal database for sekvensvarianter!

22 Huskeliste for variantvurdering Bruk av frekvensdata Synonyme varianter Missens varianter In-frame indels Nonsens varianter Out-of-frame indels Stop-loss Spleisesete varianter Intron varianter

23 Huskeliste for variantvurdering Bruk av frekvensdata Synonyme varianter Missens varianter In-frame indels Nonsens varianter Out-of-frame indels Stop-loss Spleisesete varianter Intron varianter o o frekvens i 1000genome, esp, CSAgilent, In-house databaser predikert nytt spleisesete (prediksjonsprogram i AlaMut) rapportert i databaser/litteratur kan påvirke bindingsseter for spleiseregulatoriske faktorer, men foreløpig mangler vi gode prediksjonsverktøy kan ha en rekke andre effekter på RNA stabilitet, lokalisasjon og translasjonhastighet

24 Huskeliste for variantvurdering Bruk av frekvensdata Synonyme varianter Missens varianter In-frame indels Nonsens varianter Out-of-frame indels Stop-loss Spleisesete varianter Intron varianter Nonsens som sannsynlig aktiverer nonsense mediated decay (NMD). lokalisert oppstrøms for de siste 50 basene i nest siste ekson. er varianten rapportert tidligere hos pasienter med samme fenotype? Ved dominant arvegang: er haploinsuffisiens årsak til sykdom? er fenotypen forskjellig fra missense varianter? Ved recessiv arvegang: er andre nonsens varianter forbundet med sykdom?) Nonsens som ikke aktiverer NMD. Lokalisert nedstrøms for de siste 50 basene i nest siste ekson. Det vil si at det sannsynligvis lages trunkert protein er varianten rapportert tidligere hos pasienter med samme fenotype? er det andre kjente sykdomsgivende nonsens varianter i samme område (som ikke aktiverer NMD)? er det en kjent proteinfunksjon knyttet til C-terminalen? er det sannsynlig at C-terminalen er viktig for proteinfolding?

25 Klasse 2 sannsynlig normalvariant Enighet om følgende kriterier: Frekvens i kontroller er betydelig, men ikke bra nok for klasse 1 (høyere enn forventet prevalens) Ko-segregerer ikke med sykdom (syk uten varianten) Påvist hos frisk forelder (dominant arvegang med 100% penetrans) Varierende bruk av følgende kriterier: Synonyme varianter og introniske varianter (utenfor konsensus spleisesete) som i følge prediksjonsprogrammer ikke introduserer ett nytt spleisesete. Grad av konservering på DNA nivå (phylop og phastcons): Dersom den aktuelle nukleotiden ikke er godt konservert eller ikke befinner seg i en godt konservert region på DNA nivå settes varianten i klasse 2

26 Klasse 3 usikker variant

27 2007 Svarrapportering av VUS er; essensielt og ikke essensielt Bell et al 2007 Det er essensielt at laboratoriet har databaser med oversikt over varianter og pasienter, og har mulighet til oppdatering av svarrapporter ved reklassifisering på bakgrunn av nye opplysninger. Det er essensielt at betegnelsene polymorfi og mutasjon ikke benyttes i en svarrapporten Terminologi; Sekvensvariant/DNA-variant av ukjent klinisk betydning Det er essensielt å inkludere hvilke analyser som er utført Om noen av analysene for screening ikke er utført (f.eks mangler exon 6,7,8), bør dette oppgis Det er ikke essensielt å dokumentere hele prediksjons- og klassifiseringsarbeidet som fører fram til klasse 3 varianten (VUS en). Dette arbeidet bør lagres i laboratoriets databaser. Ved reklassifisering bør imidlertid begrunnelsen dokumenteres grundig. Tromsø 2014; Genetikkfaget ruster seg for framtiden

28 Svarrapportering; hvem trenger VUS-svar? Bell et al 2007 Klasse 3 varianter bør i utgangspunktet gis ut til klinikere som er trent i faget, genetikere og genetisk veiledere. Varsomhet kreves ved utgivelse av klasse 3-svar til spesialiteter som ikke forstår kompleksiteten i informasjonen: -Vurder om varianten ikke skal gis ut -Forklar mer omstendelig betydningen (annen ordlyd) -Foreslå at pasienten får svaret under genetisk veiledning Svarrapportering; hvilke VUS er skal gis ut? Bell et al 2007 Det er generelt ikke nødvendig å rapportere alle ikke-patogene varianter (klasse 2 og 3), dette kan i enkelte tilfeller føre til mistolking av svaret. Det kan inkluderes i svarrapporten at ikke-patogene varianter ikke rapporteres. Det kan være viktig å rapportere VUS er når den kliniske sammenhengen er usikker, eller når det er sterk klinikk og ingen patogene funn. Det er i utgangspunktet ikke anbefalt å utføre prediktiv testing basert på funn av en VUS. Det kan gjøres i spesielle tilfeller under god genetisk veiledning og ved segresjonsanalyse. Tromsø 2014; Genetikkfaget ruster seg for framtiden

29 It is important that findings of uncertain significance are included in reports, as their significance may become clear at a later date. Attempts should be made to explain significance of the finding using literature, additional databases, prediction programs and other means, and to report the likelihood of the finding in respect to the clinical question asked.

30 Klasse 3, usikker variant (VUS) Påvist i friske kontroll grupper Endring til lignende aminosyre Samme aminosyreendring funnet i andre arter Ingen frekvensdata Vesentlig endring av aminosyre Høy konservering mellom arter Sannsynlig effekt på proteinstabilitet Lokalisert i funksjonelt viktig område Ingen predikert effekt på spleisesete Predikert effekt på spleisesete Predikert nytt spleisesete

31 Ved rapportering av usikre funn er det viktig å formidle hva usikker betyr: «Vurdering av variantens betydning baseres på tidligere rapporter og molekylær biologisk kunnskap om varianten. I dette tilfelle mangler vi opplysninger som kan benyttes til å evaluere om varianten representerer en sjelden normalvariant eller om den kan være sykdomsgivende.»

32 Videre utredning av VUSer RNA analyser Ko-segregering med sykdom i familien (dominant nedarving) Biokjemiske analyser Funksjonelle studier i celler (celler fra pasienten eller transfekterte celler)

33 RNA analyser På varianter med predikert effekt på spleising (redusert styrke på normalt spleisesete eller dannelse av et nytt spleisesete) Uten funn av varianter, men ved sterk klinisk mistanke om at et gitt gen (2-3) er årsak til sykdom. Som diagnostisk verktøy på gener med mange små ekson og hyppig funn av spleisemutasjoner (NF1, NF2 St.Olav) Behov for RNA analyser vil øke når vi får bedre prediksjonsverktøy for å påvise mulig endring av bindingssete for spleiseregulatoriske faktorer

34 RNA analyser Tilgang på vev hvor genet uttrykkes Blodprøve i PAXGene rør /Tempur rør (RNA stabiliserende væske) Heparinblod korttidsdyrking av lymfocytter (mulighet for hemming av NMD) Biopsi dyking av fibroblaster (mulighet for hemming av NMD) Grad av feilspleising Spesifikk amplifisering av normalt transkript og bruk av SNP for verifisering av biallelisk eller monoallelisk opprinnelse. qrt-pcr spesifikk amplifisering og kvantitering av ulike transkripter

35 Alle labbene tilbyr RNA analyser ved behov (unntatt EEG-OUS) Behovet avgjøres i hvert enkelt tilfelle og da i samarbeid med kliniker.

36 Ko-segregerings analyser Viktig at klinikerne kommuniserer resultatet tilbake til lab

37 Klasse 4 sannsynlig patogen Publisert dokumentasjon, men som ikke holder til klasse 5 Nonsens (NMD). Dominant arvegang: Haploinsuffisiens er kjent årsak til sykdom. Recessive arvegang: Nonsens er kjent årsak til sykdom Spleisesetevarianter -1,-2,+1,+2 De novo i et gen med kjent forbindelse med fenotypen (med noe forbehold) mrna analyser viser fullstendig feilspleising Endring av funksjonelt viktige aminosyrer i godt karakteriserte protein

38 Klasse 5 - patogen Publisert dokumentasjon (helst flere uavhengige artikler) Beskrevet funnet i x uavhengige pasienter med samme fenotype Eventuelle funn i normale kontroll grupper kan forklares utfra arvegang, penetrans etc. Funksjonelle studier (kritisk gjennomgang) Kosegregering med sykdom P =1- (1/2) n (n = affekterte individer 1) (Møller P, et al., 2011) Kosegregering er ikke et bevis på at varianten er årsak til sykdom. Varianten kan være lokalisert i cis til den sykdomsgivende varianten hos den analyserte familien.

39 Variantvurdering HTS Kristian Tveten

40 Filtrering av varianter Arvemodell Varianter Gener Dominant Homozygot 8 8 Compound 25 16

41 Filtrering av varianter De novo / homozygot Kjent mutasjon i HGMD Gen med kjent sykdomsassosiasjon (HGMD, OMIM ++) Ny filtrering synonyme, intron/utr, frekvens, ikke-pass

42 Case Pasient tidligere henvist for CMT uten funn MR cerebrum forenlig med leukoencephalopati Første filtrering gir ingen funn Fjerner exonic OR splice To spleisemutasjoner i DARS2 i trans c _228-20delttinsc (Partiell exon 3 skipping - NMD) Frekvens i Finske kontroller 6 / 560 kromosomer c.492+2t>c (Ekson 5 skipping - NMD) ESP frekvens 0.03% Arvemodell Varianter Gener Dominant 306 (40) 268 (35) Homozygot 49 (8) 48 (8) Compound 222 (25) 122 (16)

43 HTS-Skien Rapporterer ikke ut klasse 3 i første runde: «Det ble ikke gjort sikre patogene funn som kan forklare pasientens tilstand. Det ble imidlertid funnet genetisk variasjon av usikker betydning.» Disse kan gis ut på forespørsel til medisinsk genetikere.

44 Hva vi ikke har sagt noe om? Varianter kan endre ekspresjonen av genet (binding av transkripsjonsfaktorer) mrna stabilitet translasjonshastighet (kodon-bruk) mm

45 Bør fremtidens diagnostikk-labber ha større fokus på funksjonelle assay? RNA RT-PCR, qrt-pcr i celler fra pasienten Kunstig system med ekson-trapping Protein Funksjonelle studier i celler fra pasienten Funksjonelle studier i transfekterte celler


Genetiske undersøkelser av biologisk materiale

Genetiske undersøkelser av biologisk materiale Genetiske undersøkelser av biologisk materiale Torunn Fiskerstrand, overlege PhD Senter for klinisk medisin og molekylærmedisin, Haukeland Universitetssykehus Institutt for klinisk medisin, Universitetet


Status i forskning: Demens og arvelighet. Arvid Rongve Psykiatrisk Klinikk Helse Fonna

Status i forskning: Demens og arvelighet. Arvid Rongve Psykiatrisk Klinikk Helse Fonna Status i forskning: Demens og arvelighet Arvid Rongve Psykiatrisk Klinikk Helse Fonna Arvelighet og genetiske metoder Alzheimers sykdom og arvelighet Hva kan vi lære av de nye genene? Betydning for behandling


Veileder for postnatal helgenoms kopitallsanalyser

Veileder for postnatal helgenoms kopitallsanalyser Norsk Selskap for Human Genetikk Veileder for postnatal helgenoms kopitallsanalyser Versjon 1.0 Forord Med matrisebasert kopitallsanalyse kom en ny æra i cytogenetisk diagnostikk da den gir høyere sensitivitet


Den genetiske revolusjon til nytte for meg?

Den genetiske revolusjon til nytte for meg? Den genetiske revolusjon til nytte for meg? Gunnar Houge Seksjonsleder/overlege Senter for medisinsk genetikk og molekylærmedisin Haukeland Universitetssykehus Hvor ofte har utviklingshemning genetisk


Født Født sånn sånn eller blitt sånn? Monica Cheng Munthe-Kaas, OUS 11.09.2013

Født Født sånn sånn eller blitt sånn? Monica Cheng Munthe-Kaas, OUS 11.09.2013 Født Født sånn sånn eller blitt blitt sånn? sånn? Monica Cheng Munthe-Kaas, OUS 11.09.2013 Innlandskongressen for Helseforskning 11 September 2013 Monica Cheng Munthe-Kaas Gener versus Miljø HJERNEVASK


Genetikk og nyfødtscreening. Trine Prescott Avdeling for medisinsk genetikk, OUS September 2011

Genetikk og nyfødtscreening. Trine Prescott Avdeling for medisinsk genetikk, OUS September 2011 Genetikk og nyfødtscreening Trine Prescott Avdeling for medisinsk genetikk, OUS September 2011 Far 1 gen Genfeil = Autosomal recessiv arv kromosompar Mor Kjønnsceller Barn Syk 25% Frisk bærer Frisk bærer


Utarbeidet av Egil Bakkeheim, Overlege Ph.D og Olav Trond Storrøsten, Seksjonsleder.

Utarbeidet av Egil Bakkeheim, Overlege Ph.D og Olav Trond Storrøsten, Seksjonsleder. Norsk senter for cystisk fibrose Nasjonale kompetansetjenester for sjeldne diagnoser og funksjonshemninger Evaluering og oppfølging av individer som etter nyfødt-screening for cystisk fibrose har testet


Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser

Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser PEDENDO_SISTE_slutt.qxd 18.12.2003 21:34 Side 32 Pediatrisk Endokrinologi 2003;17: 34-38 Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser Pål Rasmus Njølstad 1,2,3,Jørn V. Sagen


Obligatorisk innlevering 3kb vår 2004

Obligatorisk innlevering 3kb vår 2004 Obligatorisk innlevering 3kb vår 2004 1 I marsvin er mørk pels farge (F) dominant over albino (f), og hår (K) dominant over langt hår (k). Genene for disse to egenskapene følger prinsippet om uavhengig


Genetikkens plass i klinikken noen overordnede tanker

Genetikkens plass i klinikken noen overordnede tanker Genetikkens plass i klinikken noen overordnede tanker Trine Prescott Overlege Seksjon for klinisk genetikk Avdeling for medisinsk genetikk Oslo Universitetssykehus / Rikshospitalet 07.01.09 1 Huntington


Dialog. Fagdag Norsk forening for CF 21. April 2012. Olav-Trond Storrøsten. Norsk senter for cystisk fibrose

Dialog. Fagdag Norsk forening for CF 21. April 2012. Olav-Trond Storrøsten. Norsk senter for cystisk fibrose Dialog Fagdag Norsk forening for CF 21. April 2012 Olav-Trond Storrøsten Norsk senter for cystisk fibrose Nasjonale kompetansetjenester for sjeldne diagnoser og funksjonshemninger Kvinne- og barneklinikken


Laboratorium for medisinsk biokjemi og blodbank.

Laboratorium for medisinsk biokjemi og blodbank. Laboratorium for medisinsk biokjemi og blodbank. LAB- nytt nr 1-2008 INNHALD: Endring av metode for analyse av s-folat Gentest ved utredning av laktoseintoleranse Vurdering av glomerulær


Bioteknologi i dag muligheter for fremtiden

Bioteknologi i dag muligheter for fremtiden Bioteknologi i dag muligheter for fremtiden Arvestoff Genetisk materiale, DNA. Baser En del av et nukleotid som betegnes med bokstavene A, C, G og T. Med disse fire bokstavene skriver DNAtrådene sine beskjeder



MUSLADIN-LUEKE SYNDROM (MLS) Side 1 av 7 AVLSRÅDET FOR BEAGLE Hjem Avlsrådet Hannhundliste Valpeformidling Helse Informasjon MUSLADI-LUEKE SYDROM () Avlsrådet for Beagle satser på å kartlegge forekomsten av anlegget for det såkalte


Oppgave 2b V1979 Hvor i cellen foregår proteinsyntesen, og hvordan virker DNA og RNA i cellen under proteinsyntesen?

Oppgave 2b V1979 Hvor i cellen foregår proteinsyntesen, og hvordan virker DNA og RNA i cellen under proteinsyntesen? Bi2 «Genetikk» [3B] Målet for opplæringa er at elevane skal kunne gjere greie for transkripsjon og translasjon av gen og forklare korleis regulering av gen kan styre biologiske prosessar. Oppgave 2b V1979


Referat fra Stiftelsesmøtet for Norsk Selskap for Humangenetikk 21 august 2007

Referat fra Stiftelsesmøtet for Norsk Selskap for Humangenetikk 21 august 2007 Referat fra Stiftelsesmøtet for Norsk Selskap for Humangenetikk 21 august 2007 98 personer hadde meldt seg på møtet. Dette var en gledelig start. Representanter fra et bredt fagmiljø var samlet; Senter


Antitrombin i laboratoriet

Antitrombin i laboratoriet Antitrombin i laboratoriet Carola Henriksson, Seksjonsoverlege, hematologiseksjonen, avdeling for medisinsk biokjemi, Oslo Universitetssykehus, Ullevål Hurdalsjøen, 8. juni Oslo Universitetssykehus (OUS)


Svarrutiner 23.02.09 kl. 13.30-14.00

Svarrutiner 23.02.09 kl. 13.30-14.00 TB QuantiFERON Svarrutiner 23.02.09 kl. 13.30-14.00 14.00 Fremlegg av artikkel: "T-cell Assays for Tuberculosis Infection: Deriving Cut-Offs for Conversions Using Reproducibility Data" Konklusjon på om


Utredning av arvelig hjertesykdom. Fagmøte i genetikk Genetikkfaget ruster seg for fremtiden Tromsø 5. og 6. november 2014

Utredning av arvelig hjertesykdom. Fagmøte i genetikk Genetikkfaget ruster seg for fremtiden Tromsø 5. og 6. november 2014 Utredning av arvelig hjertesykdom Fagmøte i genetikk Genetikkfaget ruster seg for fremtiden Tromsø 5. og 6. november 2014 «Hjertegruppa» Anette Bakken (Sykehuset i Telemark) Marte Gjøl Haug (St. Olavs


Kvantitative analyser av DNA og RNA

Kvantitative analyser av DNA og RNA Kvantitative analyser av DNA og RNA Randi Hovland Atle Brendehaug Gunnar Houge Senter for medisinsk genetikk og molekylærmedisin, HUS Senter for medisinsk genetikk og molekylærmedisin, HUS Senter for medisinsk


Hva er nytt? Fagdag Norsk forening for CF 21. April 2012. Olav-Trond Storrøsten. Norsk senter for cystisk fibrose

Hva er nytt? Fagdag Norsk forening for CF 21. April 2012. Olav-Trond Storrøsten. Norsk senter for cystisk fibrose Hva er nytt? Fagdag Norsk forening for CF 21. April 2012 Olav-Trond Storrøsten Norsk senter for cystisk fibrose Nasjonale kompetansetjenester for sjeldne diagnoser og funksjonshemninger Kvinne- og barneklinikken


Klinisk molekylærmedisin (5): Eksempler på funksjonelle analyser

Klinisk molekylærmedisin (5): Eksempler på funksjonelle analyser Pediatrisk Endokrinologi 2003;17: 64-69 Klinisk molekylærmedisin (5): Eksempler på funksjonelle analyser Pål Rasmus Njølstad 1,2,3, Lise Bjørkhaug 1 1 Seksjon for pediatri, Institutt for klinisk medisin


Har jeg arvelig disposisjon for hjertesykdom?

Har jeg arvelig disposisjon for hjertesykdom? Har jeg arvelig disposisjon for hjertesykdom? Nina Øyen Senter for medisinsk gene?kk og molekylærmedisin, Haukeland universitetssykehus & Ins?tuE for global helse og samfunnsmedisin, Universitetet i Bergen


Resistent lakselus - kvifor er det eit problem og korleis diagnostisere resistens?

Resistent lakselus - kvifor er det eit problem og korleis diagnostisere resistens? University of Bergen Resistent lakselus - kvifor er det eit problem og korleis diagnostisere resistens? Frank Nilsen Sea Lice Research Centre Institutt for Biologi, Universitetet i Bergen Norwegian School


Identifisering av en genvariant som viser sterk sammenheng med kullstørrelse hos norsk kvit sau.

Identifisering av en genvariant som viser sterk sammenheng med kullstørrelse hos norsk kvit sau. Identifisering av en genvariant som viser sterk sammenheng med kullstørrelse hos norsk kvit sau. DAG INGE VÅGE 1, MAREN HUSDAL 1, MATTHEW PETER KENT 1, GUNNAR KLEMETSDAL 1, THOR BLICHFELDT 2 OG INGER ANNE


Oversikt over kap. 11. Kap. 11 Den direkte påvisning av genotype skiller individuelle genomer. Fire klasser av DNA polymorfismer.

Oversikt over kap. 11. Kap. 11 Den direkte påvisning av genotype skiller individuelle genomer. Fire klasser av DNA polymorfismer. Kap. 11 Den direkte påvisning av genotype skiller individuelle genomer Oversikt over kap. 11 Fire klasser av DNA variasjon til direkte påvisning av genotype. Metoder som bruker hybridisering, elektroforese,


Norsk selskap for Humangenetikk. Referat fra Generalforsamlingen Norsk Selskap for Humangenetikk

Norsk selskap for Humangenetikk. Referat fra Generalforsamlingen Norsk Selskap for Humangenetikk Norsk selskap for Humangenetikk Referat fra Generalforsamlingen Norsk Selskap for Humangenetikk - avholdt ved Scandic Bergen City, Bergen, 9. november 2011 Sak 1 Valg av møteleder og referent Leder Wenche


Høringsnotat. Forskrift om farmakogenetiske undersøkelser

Høringsnotat. Forskrift om farmakogenetiske undersøkelser Høringsnotat Helse- og omsorgsdepartementet Forskrift om farmakogenetiske undersøkelser Side 1 av 7 1 Hovedinnhold Helse- og omsorgsdepartementet foreslår i dette høringsnotatet en ny forskrift som skal


UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Eksamen i: MBV 1010 Cellebiologi og genetikk Eksamensdag: 3. juni 2005 Tid for eksamen: 3 timer Oppgavesettet er på 1 side Vedlegg: 1 Tillatte



STILLAS - STANDARD FORSLAG FRA SEF TIL NY STILLAS - STANDARD FORSLAG FRA SEF TIL NY STILLAS - STANDARD 1 Bakgrunnen for dette initiativet fra SEF, er ønsket om å gjøre arbeid i høyden tryggere / sikrere. Både for stillasmontører og brukere av stillaser. 2 Reviderte


04.11.2014. Ph.d-utdanningen. Harmonisering av krav i Norden

04.11.2014. Ph.d-utdanningen. Harmonisering av krav i Norden Ph.d-utdanningen Harmonisering av krav i Norden 2 1 Nasjonalt forskningsdekanmøte i Tromsø, oktober 2014 Nordic Medical Research Councils (NOS-M), november 2014 Prodekanmøte våren 2015 Dekanmøte våren



UNIVERSITETET I OSLO UNIVERSITETET I OSLO Side 1 Det matematisk-naturvitenskapelige fakultet Eksamen i: BIO1000 Eksamensdag: 4. desember 2014 Tid for eksamen: 09.00-12.00 (3 t) Oppgavesettet er på 2 side(r) Vedlegg: Ingen


Gentest for påvisning av arvelig laktasemangel (laktoseintoleranse)

Gentest for påvisning av arvelig laktasemangel (laktoseintoleranse) Oslo universitetssykehus HF Postboks 4959 Nydalen 0424 Oslo Informasjonsskriv Sentralbord: 02770 Klinikk for diagnostikk og intervensjon Avdeling for medisinsk biokjemi Gentest for påvisning av arvelig


Eksomsekvensering og MODY Nålen i høystakken eller nyttig diagnostisk verktøy?

Eksomsekvensering og MODY Nålen i høystakken eller nyttig diagnostisk verktøy? Eksomsekvensering og MODY Nålen i høystakken eller nyttig diagnostisk verktøy? Lege og stipendiat Henrik Irgens KG Jebsen Senter for diabetesforskning HUS/UIB MODY Klassiske kliniske kriterier: Dominant


Bruk av genteknologiske analyser ved diagnostikk av luftveisinfeksjoner. Gardermoen 27.02.08. Svein Arne Nordbø

Bruk av genteknologiske analyser ved diagnostikk av luftveisinfeksjoner. Gardermoen 27.02.08. Svein Arne Nordbø Bruk av genteknologiske analyser ved diagnostikk av luftveisinfeksjoner Gardermoen 27.2.8 Svein Arne Nordbø Aktuelle genteknologiske metoder Hybridiseringsmetoder Ampifikasjonsmetoder PCR Konvensjonell


Kontinuasjonseksamen, MEDSEM2/ODSEM2/ERNSEM2 høst 2007 Onsdag 20. februar 2008 kl. 09:00-15:00

Kontinuasjonseksamen, MEDSEM2/ODSEM2/ERNSEM2 høst 2007 Onsdag 20. februar 2008 kl. 09:00-15:00 Kontinuasjonseksamen, MEDSEM2/ODSEM2/ERNSEM2 høst 2007 Onsdag 20. februar 2008 kl. 09:00-15:00 A. (18) Psoriasis er en sykdom som viser multifaktoriell arv. 1. Forklar hva som menes med begrepet multifaktoriell


Ataksier. Jeanette Koht Nevrolog Drammen sykehus. Frambu 22.september 2015

Ataksier. Jeanette Koht Nevrolog Drammen sykehus. Frambu 22.september 2015 Ataksier Jeanette Koht Nevrolog Drammen sykehus Frambu 22.september 2015 Ataksi= uten orden Nyttig om hjernen Hjernen veier ca 1.5 kilo ~60% fett Signaler føres ~ 500km /time Over 100 milliarder nerveceller


Genetisk testing for helseformål

Genetisk testing for helseformål Genetisk testing for helseformål I HVILKE SITUASJONER VIL MAN OVERVEIE EN GENETISK TEST? FAGLIG GENETISK RÅDGIVNING HVA LETER MAN ETTER I EN GENETISK TEST? DIN BESLUTNING Genetisk testing for helseformål


Diagnostisk panel og eksomsekvensering tre års erfaring

Diagnostisk panel og eksomsekvensering tre års erfaring Diagnostisk panel og eksomsekvensering tre års erfaring Helle Høyer Overingeniør, PhD Seksjon for medisinsk genetikk Sykehuset Telemark HF DISPOSJON Hvordan brukes dypsekvensering på Sykehuset Telemark


UNIVERSITY OF OSLO. Faculty of Mathematics and Natural Sciences

UNIVERSITY OF OSLO. Faculty of Mathematics and Natural Sciences Page 1 UNIVERSITY OF OSLO Faculty of Mathematics and Natural Sciences Exam in BIO4210/9210 Classification and Phylogeny Day of exam: 13. December 2011 Exam hours: 9.00-12.00 (3 hours) This examination



UNIVERSITETET I AGDER FAKULTET FOR TEKNOLOGI OG REALFAG EKSAMEN Emnekode: BI0105 Emnenavn: Genetikk og evolusjon Dato: 21. november 2011 Varighet: 2 timer Antall sider inkl. forside 8 Tillatte hjelpemidler: Kalkulator Merknader:


Differensialtelling av prøver med lave leukocytter på CellaVision DM96

Differensialtelling av prøver med lave leukocytter på CellaVision DM96 Differensialtelling av prøver med lave leukocytter på CellaVision DM96 Lamya Garabet 1, Siri Lund Støtterud 1, Siri Grønsleth 1, Erik Kolberg Amundsen 2, Tor-Arne Hagve 1 1 Tverrfaglig laboratoriemedisin



FLERVALGSOPPGAVER ARV FLERVALGSOPPGAVER ARV Hvert spørsmål har ett riktig svaralternativ. Arv 1 En organisme med to identiske alleler for en egenskap blir kalt A) homozygot B) dominant C) selvpollinerende D) heterozygot Arv


The Future of Academic Libraries the Road Ahead. Roy Gundersen

The Future of Academic Libraries the Road Ahead. Roy Gundersen The Future of Academic Libraries the Road Ahead Roy Gundersen Background Discussions on the modernization of BIBSYS Project spring 2007: Forprosjekt modernisering Process analysis Specification Market


Arrangører: Norsk forening for medisinsk genetikk (NFMG), i samarbeid med Norsk selskap for human genetikk (NSHG).

Arrangører: Norsk forening for medisinsk genetikk (NFMG), i samarbeid med Norsk selskap for human genetikk (NSHG). Faglig møte i genetikk: NYE METODER NYE UTFORDRINGER 25. og 26. november 2009 Arrangører: Norsk forening for medisinsk genetikk (NFMG), i samarbeid med Norsk selskap for human genetikk (NSHG). Sted: Vinderen


Sannsynlighet, frekvens, usikkerhet hvordan forstå og formidle risiko?

Sannsynlighet, frekvens, usikkerhet hvordan forstå og formidle risiko? SINTEF-seminar 20/3-2014 Sannsynlighet, frekvens, usikkerhet hvordan forstå og formidle risiko? Atle Refsdal,


02.05.2011. Kasuistikk. Risiko for blodpropp. Koagulasjon - oversikt. Trombedannelse. Arvelig Trombofili

02.05.2011. Kasuistikk. Risiko for blodpropp. Koagulasjon - oversikt. Trombedannelse. Arvelig Trombofili Kasuistikk 17 år gammel pike ønsker p-piller Risiko for blodpropp Arvelig trombofili Normal anamnese indikasjon for trombofiliutredning? Ingen VTE hos din, men VTE hos mor/far/søsken: Trombofiliutredning?


Foreleser: Eivind Coward, kontor 5. etg. Datablokken. Gruppeleder: Harald Barsnes

Foreleser: Eivind Coward, kontor 5. etg. Datablokken. Gruppeleder: Harald Barsnes Foreleser: Eivind Coward, kontor 5. etg. Datablokken. Gruppeleder: Harald Barsnes Forelesninger: tirsdag og fredag 12 14 rom 2104 Øvinger: fredag 10 12 rom 2143 Gi en innføring i noen


Hemochromatose -en overbehandlet tilstand? Overlege Håvar Knutsen, Hematologisk avdeling, Ullevål.

Hemochromatose -en overbehandlet tilstand? Overlege Håvar Knutsen, Hematologisk avdeling, Ullevål. Hemochromatose -en overbehandlet tilstand? Overlege Håvar Knutsen, Hematologisk avdeling, Ullevål. Jernhomeostasen -1 (Ferrireductase) Fe3+ Fe2+ BMP-R (Ferroxidase) Fe2+ Fe3+ Fleming RE. N Engl J 2005.


Nye databasar og systematiske litteratursøk

Nye databasar og systematiske litteratursøk Nye databasar og systematiske litteratursøk Eksempel frå tema innan barnevern Gerd Vik Biblioteket Sogndal 25.11.2015 Nye databasar frå 2015 Frå 1.januar 2015: Wiley Online (Oria skal finne artiklane)


Forbruk & Finansiering

Forbruk & Finansiering Sida 1 Forbruk & Finansiering Analyser og kommentarer fra Forbrukerøkonom Randi Marjamaa basert på en undersøkelse gjennomført av TEMO/MMI for Nordea RESULTATER FRA NORGE OG NORDEN Nordea 2006-02-28 Sida


buildingsmart Norge seminar Gardermoen 2. september 2010 IFD sett i sammenheng med BIM og varedata

buildingsmart Norge seminar Gardermoen 2. september 2010 IFD sett i sammenheng med BIM og varedata buildingsmart Norge seminar Gardermoen 2. september 2010 IFD sett i sammenheng med BIM og varedata IFD International Framework for Dictionaries Hvordan bygges en BIM? Hva kan hentes ut av BIM? Hvordan


EKSAMENSOPPGAVE I BI2017 Genetikk og Evolusjon

EKSAMENSOPPGAVE I BI2017 Genetikk og Evolusjon Norges teknisk-naturvitenskapelige universitet Institutt for biologi EKSAMENSOPPGAVE I BI2017 Genetikk og Evolusjon - Faglig kontakt under eksamen: 1. aman. Mohsen Falahati Tlf.: 7351293 Prof. Christophe


Administrasjon av postnummersystemet i Norge Post code administration in Norway. Frode Wold, Norway Post Nordic Address Forum, Iceland 5-6.

Administrasjon av postnummersystemet i Norge Post code administration in Norway. Frode Wold, Norway Post Nordic Address Forum, Iceland 5-6. Administrasjon av postnummersystemet i Norge Frode Wold, Norway Post Nordic Address Forum, Iceland 5-6. may 2015 Postnumrene i Norge ble opprettet 18.3.1968 The postal codes in Norway was established in


Sammenligningen mellom Arabidopsis thaliana genomet og de kjente genomene fra cyanobakterier, gjær, bananflue og nematode, viser bl. a.

Sammenligningen mellom Arabidopsis thaliana genomet og de kjente genomene fra cyanobakterier, gjær, bananflue og nematode, viser bl. a. Sammenligningen mellom Arabidopsis thaliana genomet og de kjente genomene fra cyanobakterier, gjær, bananflue og nematode, viser bl. a. Antall gener som er involvert i cellulær kommunikasjon og signaloverføring


Genene mine og meg hva bør jeg passe på?

Genene mine og meg hva bør jeg passe på? 1 Genene mine og meg hva bør jeg passe på? Berge Solberg, professor i medisinsk etikk, Norges Teknisk Naturvitenskapelige Universitet, Medlem av Bioteknologinemnda i Norge 2 Genavlesning / sekvensering


KROPPEN LEDER STRØM. Sett en finger på hvert av kontaktpunktene på modellen. Da får du et lydsignal.

KROPPEN LEDER STRØM. Sett en finger på hvert av kontaktpunktene på modellen. Da får du et lydsignal. KROPPEN LEDER STRØM Sett en finger på hvert av kontaktpunktene på modellen. Da får du et lydsignal. Hva forteller dette signalet? Gå flere sammen. Ta hverandre i hendene, og la de to ytterste personene


Oppgave 1a Definer følgende begreper: Nøkkel, supernøkkel og funksjonell avhengighet.

Oppgave 1a Definer følgende begreper: Nøkkel, supernøkkel og funksjonell avhengighet. TDT445 Øving 4 Oppgave a Definer følgende begreper: Nøkkel, supernøkkel og funksjonell avhengighet. Nøkkel: Supernøkkel: Funksjonell avhengighet: Data i en database som kan unikt identifisere (et sett



HISTORIKK UTVIKLINGEN AV FAGET Metodekurs i medisinsk biokjemi HISTORIKK UTVIKLINGEN AV FAGET Mandag 17. september Heidi Steensland Kvalitetsutvikling i det nordiske fagmiljøet 1940 1950 1960 Skandinavisk forening for klinisk kjemi.


Endringer i neste revisjon av EHF / Changes in the next revision of EHF 1. October 2015

Endringer i neste revisjon av EHF / Changes in the next revision of EHF 1. October 2015 Endringer i neste revisjon av / Changes in the next revision of 1. October 2015 INFORMASJON PÅ NORSK 2 INTRODUKSJON 2 ENDRINGER FOR KATALOG 1.0.3 OG PAKKSEDDEL 1.0.2 3 ENDRINGER FOR ORDRE 1.0.3 4 ENDRINGER


Hjemme eller institusjonalisert. rehabilitering?

Hjemme eller institusjonalisert. rehabilitering? NSH konferanse 30. mai 2011 Rehabilitering -livet er her og nå! Hjemme eller institusjonalisert Kunnskapsesenterets nye PPT-mal rehabilitering? Gro Jamtvedt, avdelingsdirektør 1. juni 2011 2 Kunnskapsbasert


1 User guide for the uioletter package

1 User guide for the uioletter package 1 User guide for the uioletter package The uioletter is used almost like the standard LATEX document classes. The main differences are: The letter is placed in a \begin{letter}... \end{letter} environment;


Forslag til nasjonal metodevurdering

Forslag til nasjonal metodevurdering Forslagsskjema, Versjon 2 17. mars 2014 Forslag til nasjonal metodevurdering Innsendte forslag til nasjonale metodevurderinger vil bli publisert i sin helhet. Dersom forslagsstiller mener det er nødvendig


Implementeringen av ROP retningslinjen; er GAP analyser et

Implementeringen av ROP retningslinjen; er GAP analyser et Implementeringen av ROP retningslinjen; er GAP analyser et effek/vt redskap? Lars Lien, leder Nasjonal kompetansetjeneste for sam


Preimplantasjonsdiagnostikk PGD Hvorfor, hvordan, hva får vi vite? Arne Sunde

Preimplantasjonsdiagnostikk PGD Hvorfor, hvordan, hva får vi vite? Arne Sunde Preimplantasjonsdiagnostikk PGD Hvorfor, hvordan, hva får vi vite? Arne Sunde Leder, Fertilitetsseksjonen, St. Olavs Hospital HF, Trondheim Professor II, Cellebiologi, NTNU Genetiske tester før fødsel


UNIT LOG (For local use)

UNIT LOG (For local use) (EUROpean Pain Audit In Neonates) European survey of sedation and analgesia practices for ventilated newborn infants UNIT LOG (For local use) MONITORING OF INCLUSIONS/ EXCLUSIONS Principal Investigators


Nasjonalt medisinsk kvalitetsregister for barne- og ungdomsdiabetes

Nasjonalt medisinsk kvalitetsregister for barne- og ungdomsdiabetes Nasjonalt medisinsk kvalitetsregister for barne- og ungdomsdiabetes Kvalitetsregisterkonferanse 2008 Tromsø 22-23. september Torild Skrivarhaug, overlege, Leder, Nasjonalt medisinsk kvalitetsregister


Institutt for biologi Faglig kontaktperson under eksamen: Berit Johansen, 98691. EKSAMEN I: BI1001 Celle- og molekylærbiologi BOKMÅL

Institutt for biologi Faglig kontaktperson under eksamen: Berit Johansen, 98691. EKSAMEN I: BI1001 Celle- og molekylærbiologi BOKMÅL Side 1 av 5 Norges teknisknaturvitenskapelige universitet Fakultet for naturvitenskap og teknologi Institutt for biologi Faglig kontaktperson under eksamen: Berit Johansen, 98691 EKSAMEN I: BI1001 Celle-


The internet of Health

The internet of Health The internet of Health! Biler, helse og fremtiden!! Velkon 2014, 22. October 2014 Nard Schreurs, IKT-Norge Få ut begrepet «pasient» av tanker om helse. Aldring 1980-2010 Menn 72 år til 79 år Kvinner 79


BIO 1000 LAB-ØVELSE 2. Populasjonsgenetikk 20. september 2005

BIO 1000 LAB-ØVELSE 2. Populasjonsgenetikk 20. september 2005 Navn: Parti: Journalen leveres senest tirsdag 27. September 2005 i kassen utenfor labben. BIO 1000 LAB-ØVELSE 2 Populasjonsgenetikk 20. september 2005 Faglig ansvarlig: Eli K. Rueness Hovedansvarlig for



UNIVERSITETET I OSLO ØKONOMISK INSTITUTT UNIVERSITETET I OSLO ØKONOMISK INSTITUTT Utsatt eksamen i: ECON1410 - Internasjonal økonomi Exam: ECON1410 - International economics Eksamensdag: 18.06.2013 Date of exam: 18.06.2013 Tid for eksamen: kl.


Blau Syndrom/ Juvenil Sarkoidose

Blau Syndrom/ Juvenil Sarkoidose Blau Syndrom/ Juvenil Sarkoidose Versjon av 2016 1. HVA ER BLAU SYNDROM/ JUVENIL SARKOIDOSE 1.1 Hva er det? Blau syndrom er en genetisk sykdom. Sykdommen gir


Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling?

Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling? Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling? Hege G. Russnes Forsker ved Avd. For Genetikk, Institutt for Kreftforskning og overlege ved Avd. For Patologi Oslo Universitetssykehus


Kapittel 10, del 2: Klassisk genetikk: Mendels arvelover. -forhold som influerer fenotypen slik at den avviker fra det Mendel observerte:

Kapittel 10, del 2: Klassisk genetikk: Mendels arvelover. -forhold som influerer fenotypen slik at den avviker fra det Mendel observerte: Kapittel 10, del 2: Klassisk genetikk: Mendels arvelover -forhold som influerer fenotypen slik at den avviker fra det Mendel observerte: 1. Dominansforhold 2. Multiple allel 3. Geninteraksjon 4. Genuttrykk


10/8/2013. video1. Progressive axonopathy (PA) Diagnostiske tester. Patellar refleks. Plasserings refleks

10/8/2013. video1. Progressive axonopathy (PA) Diagnostiske tester. Patellar refleks. Plasserings refleks Progressive axonopathy (PA) en sykdom i nervesystemet som begrensen hundens evne til å kontrollere bevegelsene sine Patellar refleks Diagnostiske tester Plasserings refleks erve konduktivitet (evne til


Plagiat og PhD: Hva gjør man med det? Kunnskapsløs eller juksemaker? Plagiatsaker 18.09.2009

Plagiat og PhD: Hva gjør man med det? Kunnskapsløs eller juksemaker? Plagiatsaker 18.09.2009 Plagiat og PhD: Hva gjør man med det? Ole Bjørn Rekdal, Høgskolen i Bergen Solstrand 17. sept., 2009 Kunnskapsløs eller juksemaker? Tvilen skal komme tiltalte til gode Hvordan eliminere tvilen? Plagiatprøve?


Hvordan kan kartleggingen av laksens genom bidra til å løse utfordringene i norsk havbruksnæring

Hvordan kan kartleggingen av laksens genom bidra til å løse utfordringene i norsk havbruksnæring Hvordan kan kartleggingen av laksens genom bidra til å løse utfordringene i norsk havbruksnæring Sigbjørn Lien Centre for Integrative Genetics (CIGENE) Institutt for husdyr- og akvakulturvitenskap (IHA)



BIOTEKNOLOGISKOLEN - TEKSTUTSKRIFTER FILM 10 - Biobanker: Levende innskudd BIOTEKNOLOGISKOLEN - TEKSTUTSKRIFTER FILM 10 - Biobanker: Levende innskudd 00:17 Bioteknologiskolen 00:20 Biobanker: Levende innskudd 00:31 Frø, blod, sæd eller kroppsvev. Over hele verden forskes det


Medisinsk statistikk, KLH3004 Dmf, NTNU 2009. Styrke- og utvalgsberegning

Medisinsk statistikk, KLH3004 Dmf, NTNU 2009. Styrke- og utvalgsberegning Styrke- og utvalgsberegning Geir Jacobsen, ISM Sample size and Power calculations The essential question in any trial/analysis: How many patients/persons/observations do I need? Sample size (an example)


Verktøy for å håndtere siteringer og referanser i masteroppgaven. Citation and reference tools for your master thesis. Citations and references

Verktøy for å håndtere siteringer og referanser i masteroppgaven. Citation and reference tools for your master thesis. Citations and references Citation and reference tools for your master thesis Verktøy for å håndtere siteringer og referanser i masteroppgaven Citations and references The citation goes into the body text and points to the full


Hvorfor jobbe. kunnskapsbasert?

Hvorfor jobbe. kunnskapsbasert? Regional ReHabiliteringskonferanse Sunnaas sykehus HF og Helse Sør-Øst RHF 22. Oktober 2013 Kunnskapsesenterets Hvorfor jobbe nye PPT-mal kunnskapsbasert? Gro Jamtvedt, avdelingsdirektør, professor i fysioterapi


Brystkreft og gener. Vårmøtet 2013. Britt Fritzman

Brystkreft og gener. Vårmøtet 2013. Britt Fritzman Brystkreft og gener Vårmøtet 2013 Britt Fritzman Hjelp jeg har fått brystkreft! Hvilken behandling skal jeg ha? Overlever jeg? Det er ingen i familien min som har hatt brystkreft! Hva har jeg gjort galt


Hvor finner vi flått på vårbeiter? - og betydning av gjengroing for flåttangrep på lam på vårbeite

Hvor finner vi flått på vårbeiter? - og betydning av gjengroing for flåttangrep på lam på vårbeite Hvor finner vi flått på vårbeiter? - og betydning av gjengroing for flåttangrep på lam på vårbeite Lucy Gilbert, Lise Grove, Unni Støbet Lande, Ingeborg Klingen, Kirstyn Brunker Gjenngroing På verdensbasis



OTC USE IN NORWAY FOR PARACETAMOL, ATC-CODE: N02BE01 OTC USE IN NORWAY FOR PARACETAMOL, ATC-CODE: N02BE01 To gain OTC prescription status for a medicinal product an application in accordance with A guideline on changing the classification for the supply


Periodisk NLRP 12-Forbundet Feber

Periodisk NLRP 12-Forbundet Feber Periodisk NLRP 12-Forbundet Feber Versjon av 2016 1. HVA ER PERIODISK NLRP 12-FORBUNDET FEBER 1.1 Hva er det? Sykdommen er arvelig. Det endrede genet ansvarlig


Passasjerer med psykiske lidelser Hvem kan fly? Grunnprinsipper ved behandling av flyfobi

Passasjerer med psykiske lidelser Hvem kan fly? Grunnprinsipper ved behandling av flyfobi Passasjerer med psykiske lidelser Hvem kan fly? Grunnprinsipper ved behandling av flyfobi Øivind Ekeberg 5.september 2008 Akuttmedisinsk avdeling, Ullevål universitetssykehus Avdeling for atferdsfag, Universitetet


Mendelsk Genetikk (kollokvium 01.09.2005)

Mendelsk Genetikk (kollokvium 01.09.2005) Mendelsk Genetikk (kollokvium 01.09.2005) 1) Hos marsvin er allelet som koder for svart pels (B) dominant i forhold allelet som gir hvit pels (b). Halvparten av avkommet i et kull var hvite. Hvilke genotyper


20.01.2012. Brukerkrav og use case diagrammer og -tekst 19. januar 2012. Agenda. Brukerkrav og use case. Diagrammer Tekst.

20.01.2012. Brukerkrav og use case diagrammer og -tekst 19. januar 2012. Agenda. Brukerkrav og use case. Diagrammer Tekst. Brukerkrav og use case diagrammer og -tekst 19. januar 2012 Agenda Brukerkrav og use case Diagrammer Tekst Praktisk eksempel 1 OOAD i livsløpsperspektiv Krav Design Konstruksjon Her er vi i nå Testing


The regulation requires that everyone at NTNU shall have fire drills and fire prevention courses.

The regulation requires that everyone at NTNU shall have fire drills and fire prevention courses. 1 The law The regulation requires that everyone at NTNU shall have fire drills and fire prevention courses. 2. 3 Make your self familiar with: Evacuation routes Manual fire alarms Location of fire extinguishers


Kurs i kunnskapshåndtering å finne, vurdere, bruke og formidle forskningsbasert kunnskap i praksis. Hege Kornør og Ida-Kristin Ørjasæter Elvsaas

Kurs i kunnskapshåndtering å finne, vurdere, bruke og formidle forskningsbasert kunnskap i praksis. Hege Kornør og Ida-Kristin Ørjasæter Elvsaas Kurs i kunnskapshåndtering å finne, vurdere, bruke og formidle forskningsbasert kunnskap i praksis 16.mars 2007 Hege Kornør og Ida-Kristin Ørjasæter Elvsaas Nasjonalt kunnskapssenter for helsetjenesten


Juridiske aspekter ved publisering i åpne institusjonelle arkiv

Juridiske aspekter ved publisering i åpne institusjonelle arkiv Juridiske aspekter ved publisering i åpne institusjonelle arkiv Professor dr juris Olav Torvund Publisering i åpne institusjonelle arkiv Førstegangspublisering Masteroppgaver Doktoravhandlinger (?) Grålitteratur


2006: Fasting glucose 7.0 mmol/l or A two-hour post glucose challenge value 11.1 mmol/l. Impaired glucose tolerance (IGT) is defined as a fasting

2006: Fasting glucose 7.0 mmol/l or A two-hour post glucose challenge value 11.1 mmol/l. Impaired glucose tolerance (IGT) is defined as a fasting 2006: Fasting glucose 7.0 mmol/l or A two-hour post glucose challenge value 11.1 mmol/l. Impaired glucose tolerance (IGT) is defined as a fasting glucose


Smertefysiologi. Jan Sture Skouen Seksjonsoverlege, AFMR, Professor, UiB

Smertefysiologi. Jan Sture Skouen Seksjonsoverlege, AFMR, Professor, UiB Smertefysiologi Jan Sture Skouen Seksjonsoverlege, AFMR, Professor, UiB Formålet med foredraget Basale mekanismer for sensitivisering Hvordan kan sensitivisering oppstå? Genetikk og generaliserte muskelsmerter


Lavkarbo-effekterog - bivirkninger

Lavkarbo-effekterog - bivirkninger Lavkarbo-effekterog - bivirkninger Mange går pådiett -lavkarboer populært 17 % har gått (siste år) eller går pådiett 640 000 nordmenn 280 000 går eller har gått pålavkarbo, 100 000 følger myndighetenes


NYHETSAVIS NR. 3/99 November 1999

NYHETSAVIS NR. 3/99 November 1999 NYHETSAVIS NR. 3/99 November 1999 INNHOLD: Hormonlaboratoriet 40 år Analysenytt Nytt referanseområde for fritt T 3 Nytt referanseområde for DHEA-SO 4 Ny metode for IGF bindeprotein 3 (IGFBP-3) i serum


Norwegian FAOS, version LK1.0

Norwegian FAOS, version LK1.0 Norwegian FAOS, version LK1.0 The KOOS form was translated from Swedish into Norwegian by the Norwegian Arthroplasty Register (NAR). The Norwegian National Knee Ligament Registry (NKLR) translated the


Lyme nevroborreliose. Diagnostikk og behandling

Lyme nevroborreliose. Diagnostikk og behandling Lyme nevroborreliose Diagnostikk og behandling Bakgrunn Mangler diagnostisk gullstandard Mangler gode behandlingsstudier Mål 1. Å undersøke om peroral doksysyklin er et adekvat behandlingsalternativ ved


Prinsipper ved rapportering av resistenssvar. Truls Leegaard Akershus universitetssykehus

Prinsipper ved rapportering av resistenssvar. Truls Leegaard Akershus universitetssykehus Prinsipper ved rapportering av resistenssvar Truls Leegaard Akershus universitetssykehus AFA-kurs nov. 2015 Er dette noe å bry seg om? Som laboratorium kan man ha stor inflydelse på hva som faktisk brukes


Morten Walløe Tvedt, Senior Research Fellow, Lawyer. Seminar 6.juni 2008

Morten Walløe Tvedt, Senior Research Fellow, Lawyer. Seminar 6.juni 2008 Morten Walløe Tvedt, Senior Research Fellow, Lawyer Seminar 6.juni 2008 My Background: Marine and Fish Genetic Resource: Access to and Property Rights of Aquaculture Genetic Resources Norwegian Perspectives


Molekylærgenetiske og cytogenetiske metoder innen diagnostikk

Molekylærgenetiske og cytogenetiske metoder innen diagnostikk Molekylærgenetiske og cytogenetiske metoder innen diagnostikk FISH - påvisning av fravær/tilstedeværelse av spesifikke sekvenser - informasjon om plassering - avhengig av celler i deling Sangers sekvensering
