Ti grunner for å leve i håpet Dr Ed Wild

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Begynne med side:

Download "Ti grunner for å leve i håpet Dr Ed Wild"

Transkript

1 Ti grunner for å leve i håpet Dr Ed Wild Clinical Lecturer, UCL Institute of Neurology Specialist Registrar, National Hospital for Neurology & Neurosurgery Co-founder & Editor-in-Chief, HDBuzz

2

3

4

5

6 Huntington sykdom forskningsnytt. Folkelig språk. Skrevet av forskere. For det internasjonale HS samfunnet.

7 How to find us HDBuzz.net hda.org.uk & other lay organisation sites Facebook hdbuzzfeed Youtube hdbuzzfeed

8

9 En Huntington sykdom er den mest kurerbare av de ukurerbare nervesykdommer.

10 To Det globale Huntington samfunnet

11

12 Tre Det gyldne vindu av muligheter Neuroner kjemper Neuroner dør Friske neuroner Sykdomstegn Genetisk test Symptomer

13 Fire Å ha symptomer Four betyr ikke at det er for sent Født med HD gen Gen avslått

14 Fem Vitenskap utvikles kontinuerlig

15 Her kommer den vitenskapelige delen

16 Hva skyldes Huntington sykdom?

17 Perspektiv Antall stjerner i vår galakse = = 100 tusen million (1011) 100 = Cell Cells in the human body = 10 million million (1013) Protein the machine The huntingtin protein Cytoplasm String of amino acids Nucleus RNA Huntingtin the message RNA DNA the book Therecipe huntingtin gene 1 gene = 1 recipe

18

19 Perspektiv The huntingtin protein Huntingtin RNA The huntingtin gene

20

21 Gen TCCTTCCAGCAGCAGCAGCAG S F F Q Q Q Q Q Q Q Q Q Protein

22 Normalt huntingtin protein Mutant huntingtin protein

23 Endring i form gir Endring i funksjon

24 Folkefiende #1

25

26

27 Ed s Topp Fem 1. Redusere produksjon av mutant protein 2. Forbedre kommunikasjon 3. Støtte neuroner 4. Redusere inflammatoriske toksiner 5. Beskytte gen-bytte Gen deaktivering PDE hemming Neurotropiner / TrK KMO hemming HDAC4 hemming

28 Gen-deaktiverings terapi (huntingtin senkning terapi) Gen-deaktiverings terapi (ASO, RNAi) STOP Huntingtin protein Huntingtin RNA Huntingtin gen

29 Gene silencing: progress Many successes in HD mice 3 primate safety trials ALS trial just finished drug was safe 3 different labs negotiating with FDA Trial in HD patients now being planned Search HDBuzz for gene silencing

30 Gen-deaktivering: fremdrift Mange suksesser i HD-mus 3 sikkerhetsstudier i primater ALS studie akkurat avsluttet medikamentet er trygt 3 forskjellige laber forhandler med FDA Studier på HD-pasienter starter snart Søk HDBuzz for gene silencing

31 $32 million $360 million HDBuzz.net/122

32

33

34

35

36 Zinc fingers HDBuzz.net/122

37 Ed s Topp Fem 1. Redusere produksjon av mutant protein 2. Forbedre kommunikasjon 3. Støtte neuroner 4. Redusere inflammatoriske toksiner 5. Beskytte gen-bytte Gen deaktivering PDE hemming Neurotropiner / TrK KMO hemming HDAC4 hemming

38

39 camp cgmp PDE

40 PDE10 inhibition in HD: Improves symptoms, cell damage in HD mice Human imaging trial successfully completed Drug trial now happening HDBuzz.net/086

41 PDE10 hemming i HD: Pfizer Bedrer symptomer og celleødeleggelse i HD-mus Vellykket human billeddiagnostisk studie fullført Medikamentstudie igang HDBuzz.net/086

42

43 Ed s Topp Fem 1. Redusere produksjon av mutant protein 2. Forbedre kommunikasjon 3. Støtte neuroner 4. Redusere inflammatoriske toksiner 5. Beskytte gen-bytte Gen deaktivering PDE hemming Neurotropiner / TrK KMO hemming HDAC4 hemming

44

45 Neurotropiske faktorer Cortex BDNF GDNF Striatum

46 BDNF TrK agonist TrK receptor

47 Ed s Topp Fem 1. Redusere produksjon av mutant protein 2. Forbedre kommunikasjon 3. Støtte neuroner 4. Redusere inflammatoriske toksiner 5. Beskytte gen-bytte Gen deaktivering PDE hemming Neurotropiner / TrK KMO hemming HDAC4 hemming

48 Microglia hjernens immunceller

49 Quin and Kyna Quinolinic acid (Quin) Kynurenic acid (Kyna) Microglia Neuron

50 Normalsituasjonen

51 Situasjon med HS

52

53 HDBuzz.net/032 KMO hemming: hva kommer så? Flere team arbeider med KMO hemmere Vellykket i mus CHDI s har annonsert sin toppkanditat: CHDI-246 Fordelaktige forandringer i CSF (cerebrospinalvæsken) Humanstudier planlegges

54 Ed s Topp Fem 1. Redusere produksjon av mutant protein 2. Forbedre kommunikasjon 3. Støtte neuroner 4. Redusere inflammatoriske toksiner 5. Beskytte gen-bytte Gen deaktivering PDE hemming Neurotropiner / TrK KMO hemming HDAC4 hemming

55 Transkripsjonsregulering AKA genbytte RNA Any protein Transcription DNA

56 Genbytte som terapeutisk mål RNA Histone deacetylase (HDAC) inhibitors Histones Transcription HDAC DNA

57 HDAC4

58 CHDI s HDAC4 prosjekt Et medikament som treffer målet Bedret ikke musen Enzymets rolle er forvirrende Noe å gjøre med huntingtin økningen Forskningen fortsetter!

59

60 Mange mål i pipeline Medikamentforskning Identifisere mål, finne eller lage molekyler Preklinisk fase Forsøk I celler og dyr Kliniske studier på mennesker Godkjenning

61 Medikamentforskning Identifisere mål, finne eller lage molekyler Preklinisk fase Forsøk I celler og dyr Kliniske studier på mennesker Godkjenning

62

63 Medikamentene kommer

64 To ting å tenke på

65

66 La meg få vite når de tester kuren

67

68

69 enroll-hd.org

70 Vi trenger å snakke om spinalpunktering... [lukk øynene hvis du er pysete]

71

72

73

74 Det passer aldri å ha HD, men til nå er det det historisk beste tidspunktet. Rebecca Potter, Guardian 2010

75

Det sitter i klisteret

Det sitter i klisteret Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Proteiner som skrur av DNA ved Huntingtons sykdom: Mer enn hva man ser ved første

Detaljer

Så, hvordan lager man nye nerveceller?

Så, hvordan lager man nye nerveceller? Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Å omdanne hudceller til hjerneceller: et gjennombrudd innen forskning på Huntingtons

Detaljer

Gendeaktivering er en gylden mulighet

Gendeaktivering er en gylden mulighet Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Gendeaktiverende medikamenter trygge for ALS pasienter... fremskynder studier på

Detaljer

Kokeboka, oppskriften og kirsebærpaien

Kokeboka, oppskriften og kirsebærpaien Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Farefull spleising - en ny måte å tenke om det skadelige huntingtinproteinet Forskere

Detaljer

Fettstoffer og hjernen

Fettstoffer og hjernen Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Spesielle 'hjernefett' injeksjoner hjelper HSmus Direkte injeksjoner i hjernen til

Detaljer

Trening øker gjenvinning i celler Natur og miljø

Trening øker gjenvinning i celler Natur og miljø Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Trening øker gjenvinning i celler Trening øker cellulær gjenvinning hos mus. Er det

Detaljer

Kan triste mus hjelpe i behandlingen av Huntington sykdom? Depresjon ved HS

Kan triste mus hjelpe i behandlingen av Huntington sykdom? Depresjon ved HS Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Kan triste mus hjelpe i behandlingen av Huntington sykdom? Hva kan vi lære om depresjonssymptomer

Detaljer

CAG repetisjoner og gråsonen

CAG repetisjoner og gråsonen Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Hvor lang er for lang? Nye tanker om "gråsonen" ved Huntington sykdom Kan et middels

Detaljer

Liftoff: Første mennesker behandlet med "gene silencing" legemidler mot HS! Geninaktivering

Liftoff: Første mennesker behandlet med gene silencing legemidler mot HS! Geninaktivering Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Liftoff: Første mennesker behandlet med "gene silencing" legemidler mot HS! Viktig

Detaljer

Blod-hjerne-barrieren

Blod-hjerne-barrieren Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Kan en egen transporttjeneste i hjernen få legemidler mot Huntingtons sykdom dit

Detaljer

Morgensesjon: Nye mulige mål

Morgensesjon: Nye mulige mål Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Terapikonferansen 2014: dag 1 HDByzz rapporterer fra åpningsdagen av de vitenskapelige

Detaljer

Lørdag 15. september 2012

Lørdag 15. september 2012 Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. EuroBuzz nyhetene: Dag 2 EuroBuzz nyhetene: Dag 2. Ed og Jeff rapporterer fra European

Detaljer

Terapikonferansen i 2012: et tilbakeblikk Systembiologi systembiologi

Terapikonferansen i 2012: et tilbakeblikk Systembiologi systembiologi Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Terapikonferansen i 2012: et tilbakeblikk HDBuzz ser tilbake på Terapikonferansen

Detaljer

Fredag, 14. september 2012

Fredag, 14. september 2012 Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. EuroBuzz nyhetene: Dag 1 EuroBuzz nyhetene: Dag 1. Ed og Jeff rapporterer fra European

Detaljer

Vit når de skal foldes

Vit når de skal foldes Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Ny studie kaster lys over lokal degenerering i HS Hvorfor dør spesielle hjerneceller

Detaljer

Født Født sånn sånn eller blitt sånn? Monica Cheng Munthe-Kaas, OUS 11.09.2013

Født Født sånn sånn eller blitt sånn? Monica Cheng Munthe-Kaas, OUS 11.09.2013 Født Født sånn sånn eller blitt blitt sånn? sånn? Monica Cheng Munthe-Kaas, OUS 11.09.2013 Innlandskongressen for Helseforskning 11 September 2013 Monica Cheng Munthe-Kaas Gener versus Miljø HJERNEVASK

Detaljer

Hvilke medisinske behov har vi løst om 10 år?

Hvilke medisinske behov har vi løst om 10 år? Hvilke medisinske behov har vi løst om 10 år? Gry Fluge Vindedal, PhD Medisinsk rådgiver, nevrologi AbbVie AGENDA - Nevrologiens kompleksitet - «The crisis» innen den farmasøytiske industrien - Fremtidens

Detaljer

Vær oppmerksom på gapet

Vær oppmerksom på gapet Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. En helhetlig oppfølging: nye retningslinjer for behandling av HS En helhetlig oppfølging:

Detaljer

Kan muskelproblemer hjelpe til med å forklare bevegelser hos pasienter med Huntingtons sykdom? En stor bevegelse

Kan muskelproblemer hjelpe til med å forklare bevegelser hos pasienter med Huntingtons sykdom? En stor bevegelse Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Kan muskelproblemer hjelpe til med å forklare bevegelser hos pasienter med Huntingtons

Detaljer

Hva det 'store nevrodegenerasjons- gjennombruddet' betyr for Huntington sykdom Prionsykdom aggregater

Hva det 'store nevrodegenerasjons- gjennombruddet' betyr for Huntington sykdom Prionsykdom aggregater Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Hva det 'store nevrodegenerasjonsgjennombruddet' betyr for Huntington sykdom Er nylige

Detaljer

Nytt behandlingsalternativ for type 2-diabetes: Fra barken av epletreet til moderne SGLT-2 hemming i klinisk praksis

Nytt behandlingsalternativ for type 2-diabetes: Fra barken av epletreet til moderne SGLT-2 hemming i klinisk praksis SCANDINAVIAN SOCIETY FOR THE STUDY OF DIABETES SSSD Presymposium Boehringer Ingelheim Nytt behandlingsalternativ for type 2-diabetes: Fra barken av epletreet til moderne SGLT-2 hemming i klinisk praksis

Detaljer

Grenseløs forskning. Status og behov for forskning på sjeldne tilstander

Grenseløs forskning. Status og behov for forskning på sjeldne tilstander Grenseløs forskning Status og behov for forskning på sjeldne tilstander Benedicte Paus Overlege, avdeling for medisinsk genetikk, OUS Professor i klinisk genetikk, UIO Forskning på sjeldne tilstander Forskning

Detaljer

Fotograf: Wilse, A. B. / Oslo byarkiv

Fotograf: Wilse, A. B. / Oslo byarkiv Fotograf: Wilse, A. B. / Oslo byarkiv Fotograf: Wilse, A. B. / Oslo byarkiv Cøliaki alltid glutenfritt? Shuo-Wang Qiao, dr. med. Immunologisk institutt, Rikshospitalet 1 Cøliaki en folkesykdom? Studier

Detaljer

Mer kunnskap om nytte av trening ved Huntington's sykdom

Mer kunnskap om nytte av trening ved Huntington's sykdom Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Mer kunnskap om nytte av trening ved Huntington's sykdom To studier viser nytte av

Detaljer

Klinisk forskningspost ved Rikshospitalet HF

Klinisk forskningspost ved Rikshospitalet HF Klinisk forskningspost ved Rikshospitalet HF Kst. avd. sjef Øyvind Melien Avdeling for Klinisk farmakologi Møte om Klinisk utprøving Norsk Biotekforum 12. juni 2008 Målsetting Fremme klinisk forskning

Detaljer

Psykisk utviklingshemming. Gertraud Leitner Barnelege HABU SSK

Psykisk utviklingshemming. Gertraud Leitner Barnelege HABU SSK Gertraud Leitner Barnelege HABU SSK Utredning Anamnese Familie Svangerskap, fødsel Utvikling Sykdommer Informasjon fra skolen og barnehagen Klinisk undersøkelse Avdekke tilstander Utseende: spesielle kjennetegn

Detaljer

Nyheter ved nevrolupus

Nyheter ved nevrolupus Nyheter ved nevrolupus Roald Omdal Seksjon for klinisk immunologi Medisinsk divisjon Stavanger universitetssjukehus Disposisjon Bare CNS Noe grunnleggende for forståelsen Oversikt Mekanismer Noen undersøkelsesmetoder

Detaljer

Bioteknologi i dag muligheter for fremtiden

Bioteknologi i dag muligheter for fremtiden Bioteknologi i dag muligheter for fremtiden Arvestoff Genetisk materiale, DNA. Baser En del av et nukleotid som betegnes med bokstavene A, C, G og T. Med disse fire bokstavene skriver DNAtrådene sine beskjeder

Detaljer

Mikroalger til medisin; krefthemmere

Mikroalger til medisin; krefthemmere Mikroalger til medisin; krefthemmere Kari Skjånes og Hanne Skomedal Bioforsk Jord og Miljø og Plantehelse Agenda Hvorfor mikroalger som krefthemmere Kreftutvikling Potensiale Hva kan utvikles Hvordan utvikle

Detaljer

HVORDAN KAN VI KLARE Å IMPLEMENTERE FORBEDRINGER? Anne Mette Koch

HVORDAN KAN VI KLARE Å IMPLEMENTERE FORBEDRINGER? Anne Mette Koch HVORDAN KAN VI KLARE Å IMPLEMENTERE FORBEDRINGER? Anne Mette Koch 08.06.17 Implementering handler om å omsette kunnskap fra forskning til praksis. Flottorp et al. Implementeringsforskning: vitenskap for

Detaljer

Genetiske undersøkelser av biologisk materiale

Genetiske undersøkelser av biologisk materiale Genetiske undersøkelser av biologisk materiale Torunn Fiskerstrand, overlege PhD Senter for klinisk medisin og molekylærmedisin, Haukeland Universitetssykehus Institutt for klinisk medisin, Universitetet

Detaljer

Antioksidanter: mat eller tilskudd?

Antioksidanter: mat eller tilskudd? Antioksidanter: mat eller tilskudd? Rune Blomhoff Institutt for medisinske basalfag, Universitetet i Oslo, Kreft, kirurgi og transplantasjonsklinikken, Oslo Universitetssykehus Oksygen et tveegget sverd

Detaljer

Uønsket opptak av store molekyler i lever et problem som kan overkommes?

Uønsket opptak av store molekyler i lever et problem som kan overkommes? Uønsket opptak av store molekyler i lever et problem som kan overkommes? Bård Smedsrød Founder and CSO Blood clearance function of the liver: Fate of i.v. administered macromolecule ( 125 I-FSA) Blood

Detaljer

Kloning og genforskning ingen vei tilbake.

Kloning og genforskning ingen vei tilbake. Kloning og genforskning ingen vei tilbake. Sammendrag. Innen genforskning og kloning er det mange utfordringer, både tekniske og etiske. Hvordan kloning gjennomføres, hva slags teknikker som blir brukt

Detaljer

- Find and fight the cause, not the symptoms. sirnasense. Oktober 2009 Hanne M. Kristensen, CEO. A BMI Company. Member of

- Find and fight the cause, not the symptoms. sirnasense. Oktober 2009 Hanne M. Kristensen, CEO. A BMI Company. Member of - Find and fight the cause, not the symptoms Oktober 2009 Hanne M. Kristensen, CEO A BMI Company Member of sirna muligheter og utfordringer Muligheter: Skru av uttrykk av proteiner som er relatert til

Detaljer

HDYO har mer informasjon om HS tilgjengelig for unge, foreldre og profesjonelle på vår webside:

HDYO har mer informasjon om HS tilgjengelig for unge, foreldre og profesjonelle på vår webside: Hvordan føles det å ha Huntingtons sykdom? HDYO har mer informasjon om HS tilgjengelig for unge, foreldre og profesjonelle på vår webside: www.hdyo.org Har du noen gang lurt på hvordan det er å ha Huntingtons

Detaljer

HPV og molekylærbiologi Molekylære mekanismer bak HPV-indusert kreftutvikling

HPV og molekylærbiologi Molekylære mekanismer bak HPV-indusert kreftutvikling HPV og molekylærbiologi Molekylære mekanismer bak HPV-indusert kreftutvikling Irene Kraus Christiansen Nasjonalt referanselaboratorium for HPV Molekylære mekanismer ved kreftutvikling Forståelse av samspillet

Detaljer

Gensaksen CRISPR - Når ivlet. Sigrid B. Thoresen, Seniorrådgiver i Bioteknologirådet

Gensaksen CRISPR - Når ivlet. Sigrid B. Thoresen, Seniorrådgiver i Bioteknologirådet Gensaksen CRISPR - Når ivlet kan l i v e t redigeres Sigrid B. Thoresen, Seniorrådgiver i Bioteknologirådet Genterapi /Genmodifisering Editing humanity The life editor The age of the red pen CRISPR, the

Detaljer

Reproduksjon av dyrevirus. Adsorpsjon Penetrasjon og avkledning Replikasjon og transkripsjon Syntese og samling (assembly) av viruskapsid Frigjøring

Reproduksjon av dyrevirus. Adsorpsjon Penetrasjon og avkledning Replikasjon og transkripsjon Syntese og samling (assembly) av viruskapsid Frigjøring Reproduksjon av dyrevirus Adsorpsjon Penetrasjon og avkledning Replikasjon og transkripsjon Syntese og samling (assembly) av viruskapsid Frigjøring ATTACHMENT Click after each step to view process PENETRATION

Detaljer

Noen utfordringer. Knut W. Ruyter

Noen utfordringer. Knut W. Ruyter Noen utfordringer Knut W. Ruyter Noen utfordringer Forskning på pasientmateriale Bruk av sårbare pasientgrupper Placebo og krav til sammenligning Screening Forskning på pasientmateriale Registre Journaler

Detaljer

Examination paper for (BI 2015) (Molekylærbiologi, laboratoriekurs)

Examination paper for (BI 2015) (Molekylærbiologi, laboratoriekurs) Department of (Biology) Examination paper for (BI 2015) (Molekylærbiologi, laboratoriekurs) Academic contact during examination: Thorsten Hamann Phone: 91825937 Examination date: 19.12.2016 Examination

Detaljer

Uttalelse om søknad om klinisk utprøving av CTL019 genterapi

Uttalelse om søknad om klinisk utprøving av CTL019 genterapi Helsedirektoratet v/seniorrådgiver Rolf Dalseg PB 7000 St. Olavs Plass 0130 Oslo Vår ref.: 2015/113 Dato: 26.11.2015 Uttalelse om søknad om klinisk utprøving av CTL019 genterapi Sammendrag Seksjon for

Detaljer

Behandling og omsorg for pasienter med alvorlige sinnslidelser. Hva kan vi lære av nyere forskning?

Behandling og omsorg for pasienter med alvorlige sinnslidelser. Hva kan vi lære av nyere forskning? Behandling og omsorg for pasienter med alvorlige sinnslidelser Hva kan vi lære av nyere forskning? Foredrag på NSHs psykiatrikonferanse 30/10-03 Professor Svein Friis Psykiatrisk Divisjon Ullevål universitetssykehus

Detaljer

Flervalgsoppgaver: proteinsyntese

Flervalgsoppgaver: proteinsyntese Flervalgsoppgaver - proteinsyntese Hver oppgave har ett riktig svaralternativ. Proteinsyntese 1 Hva blir transkribert fra denne DNA sekvensen: 3'-C-C-G-A-A-T-G-T-C-5'? A) 3'-G-G-C-U-U-A-C-A-G-5' B) 3'-G-G-C-T-T-A-C-A-G-5'

Detaljer

Translasjonsforskning i utviklingsforstyrrelser status og muligheter i Norge

Translasjonsforskning i utviklingsforstyrrelser status og muligheter i Norge Translasjonsforskning i utviklingsforstyrrelser status og muligheter i Norge Ole A. Andreassen NORMENT, KG Jebsen Senter for Psykoseforskning Klinikk psykisk helse og avhengighet, Institutt for klinisk

Detaljer

Hurtigtesten som utføres per i dag. Åpent møte 7 januar 2008 Gentesting ved bryst- og eggstokkreft

Hurtigtesten som utføres per i dag. Åpent møte 7 januar 2008 Gentesting ved bryst- og eggstokkreft Hurtigtest egnet for formålet? Åpent møte 7 januar 2008 Gentesting ved bryst- og eggstokkreft Overlege dr philos Torunn Fiskerstrand Haukeland Universitetssykehus Hurtigtesten som utføres per i dag 23

Detaljer

Lyme nevroborreliose. Diagnostikk og behandling

Lyme nevroborreliose. Diagnostikk og behandling Lyme nevroborreliose Diagnostikk og behandling Bakgrunn Mangler diagnostisk gullstandard Mangler gode behandlingsstudier Mål 1. Å undersøke om peroral doksysyklin er et adekvat behandlingsalternativ ved

Detaljer

Fysisk aktivitet. Fysisk aktivitet. Mekanismene. Effekt av fysisk aktivitet på hjernen. Mekanismene

Fysisk aktivitet. Fysisk aktivitet. Mekanismene. Effekt av fysisk aktivitet på hjernen. Mekanismene Fysisk aktivitet Effekt av fysisk aktivitet på hjernen Masood Zangani Overlege, Akershus universitetssykehus Bergen 07.06.2012 Fysisk aktivitet Mekanismene Mekanismene Depresjon Nevrogenese Synaptisk plastisitet

Detaljer

Epigenetikk; arvesynden i ny innpakning? Dag O. Hessen University of Oslo, Dept. Biology Center of Ecological and Evolutionary Synthesis (CEES)

Epigenetikk; arvesynden i ny innpakning? Dag O. Hessen University of Oslo, Dept. Biology Center of Ecological and Evolutionary Synthesis (CEES) Epigenetikk; arvesynden i ny innpakning? Dag O. Hessen University of Oslo, Dept. Biology Center of Ecological and Evolutionary Synthesis (CEES) Den genetiske kode Oppnøstingen av den genetiske kode foregikk

Detaljer

Down syndrom, fredag 8.april.

Down syndrom, fredag 8.april. Down syndrom, fredag 8.april. Livsprognose Gj.alder: > 60 år. 1900 2-4 år 1970 ca. 35 år Siste 30 år, en fordobling av mennesker med DS > 30 års alder Mye forskning på Tr 21 i utvikling (hjerne) Mye forskning

Detaljer

Oppgave 2b V1979 Hvor i cellen foregår proteinsyntesen, og hvordan virker DNA og RNA i cellen under proteinsyntesen?

Oppgave 2b V1979 Hvor i cellen foregår proteinsyntesen, og hvordan virker DNA og RNA i cellen under proteinsyntesen? Bi2 «Genetikk» [3B] Målet for opplæringa er at elevane skal kunne gjere greie for transkripsjon og translasjon av gen og forklare korleis regulering av gen kan styre biologiske prosessar. Oppgave 2b V1979

Detaljer

Heidi Glosli Solstrandseminaret 27. oktober 2015. Utvikling av NorPedMed

Heidi Glosli Solstrandseminaret 27. oktober 2015. Utvikling av NorPedMed Heidi Glosli Solstrandseminaret 27. oktober 2015 Utvikling av NorPedMed Nasjonalt kompetansenettverk for legemidler til barn St.meld. nr. 18 (2004-2005) (Legemiddelmeldingen) Stortinget ber Regjeringen

Detaljer

Regulering av DNA Transkripsjon i Eukaryote Organismer. ID, Kull 99, Vår 2001 Frank Skorpen IKM, DMF

Regulering av DNA Transkripsjon i Eukaryote Organismer. ID, Kull 99, Vår 2001 Frank Skorpen IKM, DMF Regulering av DNA Transkripsjon i Eukaryote Organismer ID, Kull 99, Vår 2001 Frank Skorpen IKM, DMF 1 Regulering av gen-uttrykk på mange nivåer Klargjøring av DNA Transkripsjon Initiering Stopp hnrna prosessering

Detaljer

personlig harald.grevskott@egmonthm.no

personlig harald.grevskott@egmonthm.no personlig harald.grevskott@egmonthm.no fremtiden i sine hender: En ansatt i det spanske firmaet Life Length arbeider på laben i lokalene til det spanske nasjonale forskningssenteret. 54 Nr. 7 2013 Revolusjon

Detaljer

Reproduksjon av dyrevirus. Adsorpsjon Penetrasjon og avkledning Replikasjon og transkripsjon Syntese og samling (assembly) av viruskapsid Frigjøring

Reproduksjon av dyrevirus. Adsorpsjon Penetrasjon og avkledning Replikasjon og transkripsjon Syntese og samling (assembly) av viruskapsid Frigjøring Reproduksjon av dyrevirus Adsorpsjon Penetrasjon og avkledning Replikasjon og transkripsjon Syntese og samling (assembly) av viruskapsid Frigjøring ATTACHMENT Click after each step to view process PENETRATION

Detaljer

Fra kunnskap til problemløsning

Fra kunnskap til problemløsning Fra kunnskap til problemløsning Anne Katrine Eek Rådgiver, RELIS Sør-Øst Legeforeningskurs 16. november 2017. Produsentuavhengig legemiddelinformasjon for helsepersonell Disposisjon Legemiddelinteraksjoner

Detaljer

Hva er Immunterapi? Anders Sundan Senter for myelomforskning, NTNU

Hva er Immunterapi? Anders Sundan Senter for myelomforskning, NTNU Hva er Immunterapi? Anders Sundan Senter for myelomforskning, NTNU 1 3 typer immunterapi; Antistoffer som aktiverer immunforsvaret mot kreftcellene. (Anti-CTLA4, -PD1/PD1L) Antistoffer som binder kreftceller

Detaljer

Brystkreft: hyppigheten øker men dødeligheten går ned hvorfor? Lars Vatten, dr med Professor i epidemiologi. Det medisinske fakultet NTNU, Trondheim

Brystkreft: hyppigheten øker men dødeligheten går ned hvorfor? Lars Vatten, dr med Professor i epidemiologi. Det medisinske fakultet NTNU, Trondheim Brystkreft: hyppigheten øker men dødeligheten går ned hvorfor? Lars Vatten, dr med Professor i epidemiologi Det medisinske fakultet NTNU, Trondheim 1 Dødelighetskurven for brystkreft viste en svakt økende

Detaljer

En biopsykososial modell for fatigue (PSF) og depresjon (PSD) etter hjerneslag

En biopsykososial modell for fatigue (PSF) og depresjon (PSD) etter hjerneslag En biopsykososial modell for fatigue (PSF) og depresjon (PSD) etter hjerneslag En biopsykososial modell gir et tillegg til den mer tradisjonelle lineære biomedisinske modellen, nemlig psykologiske og sosiale

Detaljer

Demens Status presens

Demens Status presens Demens Status presens Geir Selbæk Alderspsykiatrisk forskningssenter SIHF / Akershus Universitetssykehus TIORDTEST Fra CERAD SMØR ARM KYST BREV DRONNING HYTTE STOKK BILLETT GRESS MOTOR Auguste Deter 1850-1906

Detaljer

Kan forskning på planter gi løsningen på Parkinsons sykdom

Kan forskning på planter gi løsningen på Parkinsons sykdom Kan forskning på planter gi løsningen på Parkinsons sykdom PS ble først beskrevet av James Parkinson i 1817 Jean-Martin Charcot 29.november 1825-16.august 1893 Parkinsonpasienten Kjendiser med PS Patologi

Detaljer

Jesper Simonsen, divisjonsdirektør Hjernehelse fra forskning til klinisk praksis,

Jesper Simonsen, divisjonsdirektør Hjernehelse fra forskning til klinisk praksis, Grensesprengende forskning gjennom innovasjon og høy kvalitet. Hva sier HO21-strategien? Hvilke virkemidler i Forskningsrådet finansierer hjerneforskning? Jesper Simonsen, divisjonsdirektør Hjernehelse

Detaljer

Godkjenning av legemidler

Godkjenning av legemidler Godkjenning av legemidler ALS-seminar 14.10.2017 Jan Petter Akselsen 27.07.17 Ap-Michaelsen krever strakstiltak for bedre tilgang til nye medisiner: Har fått nok http://www.vg.no/forbruker/helse/kreft/ap-michaelsenkrever-strakstiltak-for-bedre-tilgang-til-nye-medisiner-harfaatt-nok/a/24100353/

Detaljer

Kristin Hamre: Hvilken betydning kan epigenetikk ha for marint oppdrett? Embryo og larver Risiko/nytte fisk Bærekraft

Kristin Hamre: Hvilken betydning kan epigenetikk ha for marint oppdrett? Embryo og larver Risiko/nytte fisk Bærekraft Kristin Hamre: Hvilken betydning kan epigenetikk ha for marint oppdrett? Embryo og larver Risiko/nytte fisk Bærekraft Hva er epigenetikk? Forandringer i egenskaper/genuttrykk som skyldes miljøpåvirkninger

Detaljer

Avhengighet og gener - et evolusjonært perspektiv

Avhengighet og gener - et evolusjonært perspektiv Avhengighet og gener - et evolusjonært perspektiv Dag O. Hessen University of Oslo, Dept. Biology Center of Ecological and Evolutionary Synthesis (CEES) Det sentrale spørsmål Er vår adferd og preferanser

Detaljer

Kreftgenomikk. Ø Hvorfor er dette viktig for Pfizer? Ø Hvorfor tror vi at dette er veien fremover? Ø Utfordringer som vi ser og opplever

Kreftgenomikk. Ø Hvorfor er dette viktig for Pfizer? Ø Hvorfor tror vi at dette er veien fremover? Ø Utfordringer som vi ser og opplever Kreftgenomikk Ø Hvorfor er dette viktig for Pfizer? Ø Hvorfor tror vi at dette er veien fremover? Ø Utfordringer som vi ser og opplever Knut Martin Torgersen, PhD Medisinsk Rådgiver, Pfizer Onkologi Estimated

Detaljer

Norske søknader mot Nanomedisin FP7 1. call. Tor E. Johnsen Nanomedisin i Norge,

Norske søknader mot Nanomedisin FP7 1. call. Tor E. Johnsen Nanomedisin i Norge, Norske søknader mot Nanomedisin FP7 1. call Tor E. Johnsen Nanomedisin i Norge, 12.12.2007 Innhold Evalueringsprosessen i NMP Enkelttema som hadde muligheter for prosjekter innen nanomedisin Oversikt norske

Detaljer

5. årsoppgave, Stadium IV

5. årsoppgave, Stadium IV 5.årsoppgave,StadiumIV Medikamentellprofylakseogbehandlingavhøydesyke:Kunnskapog praksisietutvalgavnorsketuristerpåturerover3500moh Forfatter: GudveigLundeToverud Stud.Med.vedDetMedisinskeFakultetet,UniversitetetiTromsø,MK

Detaljer

R E T N I N G S L I N J E R F O R I N K L U S J O N A V K V I N N E R I M E D I S I N S K F O R S K N I N G

R E T N I N G S L I N J E R F O R I N K L U S J O N A V K V I N N E R I M E D I S I N S K F O R S K N I N G R E T N I N G S L I N J E R F O R I N K L U S J O N A V K V I N N E R I M E D I S I N S K F O R S K N I N G Kjønn som va riabel i all medisinsk fo rs k n i n g B a kgru n n Det er i økende grad blitt klart

Detaljer

Forskning på barn, spesielt genetisk forskning. Arvid Heiberg Overlege, professor (em) Avdeling for medisinsk genetikk OUS, Rikshospitalet.

Forskning på barn, spesielt genetisk forskning. Arvid Heiberg Overlege, professor (em) Avdeling for medisinsk genetikk OUS, Rikshospitalet. Forskning på barn, spesielt genetisk forskning Arvid Heiberg Overlege, professor (em) Avdeling for medisinsk genetikk OUS, Rikshospitalet. Barn som sårbar gruppe Alle barn er definert som sårbare forskningsmessig,

Detaljer

Genetikk og psykiatriske lidelser Hvilke sammenhenger ser man?

Genetikk og psykiatriske lidelser Hvilke sammenhenger ser man? Genetikk og psykiatriske lidelser Hvilke sammenhenger ser man? Ted Reichborn-Kjennerud, dr. med. Avdeling for psykisk helse Nasjonalt Folkehelseinstitutt Arv og miljø Genetiske ulikheter har lenge vært

Detaljer

LEKSJON 4: BIOTEKNOLOGI HVORDAN VI BRUKER NATURENS EGNE MEKANISMER TIL VÅR FORDEL, OG UTFORDRINGENE SOM FØLGER MED

LEKSJON 4: BIOTEKNOLOGI HVORDAN VI BRUKER NATURENS EGNE MEKANISMER TIL VÅR FORDEL, OG UTFORDRINGENE SOM FØLGER MED LEKSJON 4: BIOTEKNOLOGI HVORDAN VI BRUKER NATURENS EGNE MEKANISMER TIL VÅR FORDEL, OG UTFORDRINGENE SOM FØLGER MED KOMPETANSEMÅL Forklarebegrepene krysning og genmodifisering, og hvordan bioteknologi brukes

Detaljer

www.printo.it/pediatric-rheumatology/no/intro

www.printo.it/pediatric-rheumatology/no/intro www.printo.it/pediatric-rheumatology/no/intro Majeed Versjon av 2016 1. HVA ER MAJEED SYNDROM? 1.1 Hva er det? Majeed syndrom er en sjelden genetisk sykdom. Pasientene har kronisk tilbakevendende multifokal

Detaljer

Familiær Middelhavsfeber (FMF)

Familiær Middelhavsfeber (FMF) www.printo.it/pediatric-rheumatology/no/intro Familiær Middelhavsfeber (FMF) Versjon av 2016 2. DIAGNOSE OG BEHANDLING 2.1 Hvordan stilles diagnosen? Generelt følger man denne tilnærmingen: Klinisk mistanke:

Detaljer

Skreddersydd medisin: Dyrt og eksklusivt, eller investering i fremtidig pasient-nytte og bedre helseøkonomi?

Skreddersydd medisin: Dyrt og eksklusivt, eller investering i fremtidig pasient-nytte og bedre helseøkonomi? Skreddersydd medisin: Dyrt og eksklusivt, eller investering i fremtidig pasient-nytte og bedre helseøkonomi? Kjetil Taskén Bioteknologisenteret og Norsk senter for molekylærmedisin Universitetet i Oslo

Detaljer

Forslag til nasjonal metodevurdering av pembrolizumab

Forslag til nasjonal metodevurdering av pembrolizumab Forslagsskjema, Versjon 2 17. mars 2014 Forslag til nasjonal metodevurdering av pembrolizumab Innsendte forslag til nasjonale metodevurderinger vil bli publisert i sin helhet. Dersom forslagsstiller mener

Detaljer

FLERVALGSOPPGAVER BIOTEKNOLOGI

FLERVALGSOPPGAVER BIOTEKNOLOGI FLERVALGSOPPGAVER BIOTEKNOLOGI FLERVALGSOPPGAVER FRA EKSAMEN I BIOLOGI 2 V2008 - V2011 Disse flervalgsoppgavene er hentet fra eksamen i Biologi 2 del 1. Det er fire (eller fem) svaralternativer i hver

Detaljer

Industrien må ha tilgang til helsedata for å kunne levere innovative produkter for fremtidens helsetjenester Er vi klare?

Industrien må ha tilgang til helsedata for å kunne levere innovative produkter for fremtidens helsetjenester Er vi klare? Odd Arild Lehne, Advisor Innovation Projects, Oslo Medtech Industrien må ha tilgang til helsedata for å kunne levere innovative produkter for fremtidens helsetjenester Er vi klare? Industrien må ha tilgang

Detaljer

europeisk patentskrift

europeisk patentskrift (12) Oversettelse av europeisk patentskrift (11) NO/EP 2125711 B1 (19) NO NORGE (51) Int Cl. C07C 321/20 (2006.01) A61K 31/216 (2006.01) A61K 31/421 (2006.01) A61K 31/4402 (2006.01) A61K 31/495 (2006.01)

Detaljer

2. Fremgangsmåten ifølge krav 1, hvori dsrna-duplekset har en lengde fra 8 basepar (bp) ti 30 bp.

2. Fremgangsmåten ifølge krav 1, hvori dsrna-duplekset har en lengde fra 8 basepar (bp) ti 30 bp. 1 Patentkrav 1. Fremgangsmåte for å endre et mål-dna, der fremgangsmåten omfatter å bringe mål-dna-et i kontakt med et kompleks omfattende: (a) et Cas9-polypeptid og (b) et enkeltmolekyl-rna som er målrettet

Detaljer

HUMIRA (adalimumab) Pasienten i fokus

HUMIRA (adalimumab) Pasienten i fokus HUMIRA (adalimumab) Pasienten i fokus Pediatrisk Crohns Sykdom & Neglepsoriasis Tobias Heatta-Speicher, PhD Medical Affairs Manager LIS anbudsseminar 26. januar 2016 1 HUMIRA (adalimumab) rekombinant fullhumant

Detaljer

Spesialistsentrenes rolle i den kliniske forskningen.

Spesialistsentrenes rolle i den kliniske forskningen. Industri Helsevesen Akademia Pasient Spesialistsentrenes rolle i den kliniske forskningen. Lege Kjetil Høye Medi3 Innlandet AS, Hamar Industri Akademia Helsevesen Pasient Spesialistsentrenes rolle i den

Detaljer

Nye antidiabetika 2013

Nye antidiabetika 2013 Nye antidiabetika 2013 Kåre I. Birkeland Avd. for endokrinologi, sykelig overvekt og forebyggende medisin Oslo universitetssykehus Institutt for klinisk medisin, Universitetet i Oslo Nye antidiabtika 2013

Detaljer

HIV / AIDS -infeksjon - behandling

HIV / AIDS -infeksjon - behandling HIV / AIDS -infeksjon - behandling HIV / AIDS 1981 første gang anerkjent som distinkt sykdom Opprinnelig overført fra sjimpanse Viruset kan ha sirkulert fra 1915-1941 Trolig sirkulert blant populasjoner

Detaljer

Rusmiddelbruk. Rusmiddelbruk. Hvorfor bruke et rusmiddel? Etablering og utvikling av avhengighet: Hva skjer i hjernen?

Rusmiddelbruk. Rusmiddelbruk. Hvorfor bruke et rusmiddel? Etablering og utvikling av avhengighet: Hva skjer i hjernen? Rusmiddelbruk Etablering og utvikling av avhengighet: Hva skjer i hjernen? JØRG MØRLAND NASJONALT FOLKEHELSEINSTITUTT 1. En enkelt gang 2. Sjelden, intet fast mønster 3. På fester, i helger etc. 4. Mer

Detaljer

Legedelegerte sykepleierkonsultasjoner

Legedelegerte sykepleierkonsultasjoner Legedelegerte sykepleierkonsultasjoner FSR-lederseminar Hege Svean Koksvik 1 Eular anbefalinger Implementering Praktisk gjennomføring og erfaring fra St. Olav 2 3 BAKGRUNN Sykepleierrollen er i forandring

Detaljer

Oppgave 2b V1983 Hva er et enzym? Forklar hvordan enzymer virker inn på nedbrytningsprosessene.

Oppgave 2b V1983 Hva er et enzym? Forklar hvordan enzymer virker inn på nedbrytningsprosessene. Bi2 «Energiomsetning» [2B] Målet for opplæringa er at elevane skal kunne forklare korleis enzym, ATP og andre kofaktorar verkar, og korleis aktiviteten til enzym blir regulert i celler og vev. Oppgave

Detaljer

MOLEKYLÆRBIOLOGISK FAGDAG

MOLEKYLÆRBIOLOGISK FAGDAG MOLEKYLÆRBIOLOGISK FAGDAG Velkommen til Molekylærbiologisk institutt, Universitetet i Bergen 8. mars 2017 Forsidebilde (fotograf: Marc Niere) Dyrkede celler som vokser og deler seg i det uendelige er et

Detaljer

Kan trafikantene påvirkes gjennom nye kanaler? Hva kan vi lære av fake news og chatbots? Teknologidagene i Trondheim,

Kan trafikantene påvirkes gjennom nye kanaler? Hva kan vi lære av fake news og chatbots? Teknologidagene i Trondheim, Kan trafikantene påvirkes gjennom nye kanaler? Hva kan vi lære av fake news og chatbots? Teknologidagene i Trondheim, 25.10.17 Petter Bae Brandtzæg SINTEF pbb@sintef.no @petterbb 1 Innhold Hva virker (og

Detaljer

Kurs i behandling av kognitive vansker

Kurs i behandling av kognitive vansker KReSS Høstseminar 2013 Kurs i behandling av kognitive vansker KReSS Høstseminar 2013 To- dagers kurs fra torsdag 19.9 til fredag 20.9 Program Utvalgte tema Hvorfor kognitiv rehabilitering Presentasjon

Detaljer

Hva trenger oppstartsfirmaer for å lykkes?

Hva trenger oppstartsfirmaer for å lykkes? Unlocking the potential of innovative medicines Hva trenger oppstartsfirmaer for å lykkes? LMI Regulatorisk høstmøte 8. oktober 2013 Lucy Wabakken, Regulatory Affairs Director, PCI Biotech December, 2011

Detaljer

MOLEKYLÆRBIOLOGISK DAG

MOLEKYLÆRBIOLOGISK DAG MOLEKYLÆRBIOLOGISK DAG Velkommen til Molekylærbiologisk institutt, Universitetet i Bergen 5. mars 2015 Forsidebilde (fotograf: Marc Niere) Dyrkede celler som vokser og deler seg i det uendelige er et nyttig

Detaljer

Han Ola of Han Per: A Norwegian-American Comic Strip/En Norsk-amerikansk tegneserie (Skrifter. Serie B, LXIX)

Han Ola of Han Per: A Norwegian-American Comic Strip/En Norsk-amerikansk tegneserie (Skrifter. Serie B, LXIX) Han Ola of Han Per: A Norwegian-American Comic Strip/En Norsk-amerikansk tegneserie (Skrifter. Serie B, LXIX) Peter J. Rosendahl Click here if your download doesn"t start automatically Han Ola of Han Per:

Detaljer

Kliniske studier hos barn i et Europeisk perspektiv Ansgar Berg

Kliniske studier hos barn i et Europeisk perspektiv Ansgar Berg Kliniske studier hos barn i et Europeisk perspektiv Ansgar Berg Forskningslege/ Professor Klinisk Forskningspost- Barn Haukeland Universitetssykehus Helse-Bergen HF 2 Pediatric Regulation Pediatric Plans

Detaljer

Kognitiv miljøterapi hvordan er det forsket på?

Kognitiv miljøterapi hvordan er det forsket på? Kognitiv miljøterapi hvordan er det forsket på? Marit Solbjør Institutt for sosialt arbeid og helsevitenskap, NTNU Trøndelag Forskning og Utvikling AS Marit.Solbjor@svt.ntnu.no Hvordan er det forsket på

Detaljer

Kognitiv miljøterapi hvordan er det forsket på?

Kognitiv miljøterapi hvordan er det forsket på? Kognitiv miljøterapi hvordan er det forsket på? Marit Solbjør Institutt for sosialt arbeid og helsevitenskap, NTNU Trøndelag Forskning og Utvikling AS Marit.Solbjor@svt.ntnu.no Hvordan er det forsket på

Detaljer

Immunterapi på Utprøvingsenheten OUS. Paal Fr Brunsvig 30. 10. 2014

Immunterapi på Utprøvingsenheten OUS. Paal Fr Brunsvig 30. 10. 2014 Immunterapi på Utprøvingsenheten OUS Paal Fr Brunsvig 30. 10. 2014 Økende interesse for immunterapi! Plus chemotherapy Plus radiotherapy Immuno-Oncology Plus other immunotherapy Plus targeted therapy Immunterapi

Detaljer

Degenerativ encefalopati

Degenerativ encefalopati Degenerativ encefalopati Dennis O Brien DVM PhD, Chancellor s Chair in Comparative Neurology University of Missouri, College of Veterinary Medicine Ny informasjon Degenerativ encefalopati (DE) er en fryktelig

Detaljer