Problembakterier karakterisering og genotyping. André Ingebretsen Avdeling for smittevern og Avdeling for mikrobiologi Oslo universitetssykehus

Save this PDF as:
 WORD  PNG  TXT  JPG

Størrelse: px
Begynne med side:

Download "Problembakterier karakterisering og genotyping. André Ingebretsen Avdeling for smittevern og Avdeling for mikrobiologi Oslo universitetssykehus"

Transkript

1 Problembakterier karakterisering og genotyping André Ingebretsen Avdeling for smittevern og Avdeling for mikrobiologi Oslo universitetssykehus

2 Mikroorganismer finnes i alle miljøer?

3

4

5 Estimat av biodiversitet

6 Estimat av biodiversitet Rappé & Giovannoni2003AnnRev Microb 57:

7 Helgenomprosjekter Totalt 3701 ferdige genomprosjekter Bakterier: 3359 Archaea: 159 Eukaryoter: pågående genomprosjekter Bakterier: Archaea: planlagte genomprosjekter Bakterier:1537 Genomes online database

8

9 Strategi for genotyping av Primærstrategi: Overvåkning av infeksjonssykdommer Bekrefte reinfeksjon eller residiv infeksjon Utbruddsoppklaring i sykehus Sekundærstrategi: Fylogenetiske studier, populasjons genetikk Patogenese studier, virulens Kvalitetssikring: Krysskontaminering i lab mikroorganismer

10 Utbrudd i sykehus Bruk av typingsmetoder genererer og tester hypoteser Korrekt bruk av typing vil øke effektiviteten på kontrolltiltakene som kan føre til avledning av utbruddet Fokus på disse mikroorganismene: Saureus Cdifficile Paeruginosa Abaumannii Smaltophilia Gramnegative med økt resistens (ESBL, NDM-1) Gjær- og muggsopp

11 Klassifisering av Bacteria og Archaea Tidsepoke Før 1900 Historikk Klassifisering i hovedsak basert på Morfologi, Vekstbetingelser, Sykdomsfremkallende potensiale Morfologi, Fysiologi, Biokjemi Kjemotaksonomi, Numerisk taksonomi, DNA-DNA hybridisering Genotypiske analyser, Multilokus sekvensanalyser, Average Nucleotide Identity, Helgenom analyser

12 Genotyping Genetisk karakterisering av organismer Optimalt: Helgenomanalyse Genetiske markører Genotyping: forandringer i markørsekvenser

13 Klassifisering av typingsmetoder MORFOLOGI MLEE MLST Mikrosatellitter Populasjons biologi Evolusjon Langsiktig epidemiologi FAG-TYPING RESISTENS TYPING Typing av bakterier Kortsiktig epidemiologi METABOLSK TYPING SEROTYPING RIBOTYPING Fenotypiske metoder Genotypiske metoder VNTR/SLST PFGE NGS Systematikk OPPLØSLIGHET

14 Utbrudd av Ecoli O104:H STEC utbruddet i Tyskland 2011 Bønnespirer 3842 tilfeller 2987 labkonfirmerte Ecoli gastroenterittert 18 dødsfall 855 HUS 35 dødsfall

15 Sekvenseringsplatformer OpGen Argus Optical Mapper Ion Torrent PGM (Semiconductor

16 Utbrudd av Ecoli O104:H Mellmann A et al (2011) PLoS ONE 6(7): e22751 doi:101371/journalpone

17 Optical mapping

18 Optical mapping

19 Utbrudd av Ecoli O104:H Mellmann A et al (2011) PLoS ONE 6(7): e22751 doi:101371/journalpone

20 Helgenomsekvensering Gir oss nye metoder for å utforske den genetiske diversiteten mellom stammer av samme art Gir oss mulighet til å modifisere eksisterende metodikk Gir oss mulighet til å designe nye molekylære verktøy for rask genotyping Gir oss mulighet til å spesialkonstruere medier

21

22 PFGE = Genomisk scanning Deteksjon av DNA migrasjon

23 PFGE

24 KLEB ESBL April 2011 (21 entries) PFGE PFGE UR SS IA BLD TR TR TR UR UR UR UR BLD UR UR UR TR UR UR UR UR UR KIRTXS MEPNYOBS BKLS4 NKIS2 INTI1 INTI1 INTI1 KIRUROS OFNS3 MEPNYTX MEPNYTX MEPNYTX MEPNYTX MEPNYTX MEPNYTX NKIV1S KIRTXS KIRTXS KIRUROS BKLS4 BKLS4

25 Clostridium difficile

26 PCR ribotyping 16S 23S 5S rrna operon - Flere rrna operons pr genom -Stammeavhengig variasjon av størrelse på regionen mellom 16S-23S -Variasjon av PCR produkter der antall og størrelse vil variere fra stamme til stamme

27 Ribotyping av C difficile i Norge

28 Tandem repeats GAGCGATACAAACTGGGAAACAGGGAAACTGGGTCCACAGGA Tandem repeats Flanke Repeats Flanke

29 Variasjon i Tandem repeats Stamme 1 Stamme 2 Stamme 3 Stamme 4 Variable-Number Tandem Repeats = VNTR

30 Multilocus VNTR analyse (MLVA) Regioner med korte, tandemrepeterte DNAsekvenser finnes over hele genomet Varierer mellom bakteriestammer Antall korte, repeterte sekvenser ved valgte loci gir en unik profil innen bakteriestammen

31 MLVA på Cdifficile Markør Repetert sekvens Lokalisasjon i CD 630 A6 AAGAGC B7 ATCTTCT C6 TATTGC E7 ATAGATT F3 TTA A6 B7 C6 E7 F3 G8 H (Van den Berg et al J Clin Microb 2006; 45: ) G8 TAAAAGAG H9 TCTTCTTCC

32

33 Populasjonsstruktur Clostridium difficile

34

35 European Clostridium difficile Infection Survey laboratorier 34 land 509 pasienter Karakterisering av isolerte stammer Nov`08 65 forskjellige PCR ribotyper identifisert Lancet 2011;377:63-73

36 ECDIS net : Laboratorienettverk Harmonisering laboratoriediagnostikk Harmonisering av typingsteknikk Felles stammebank Overvåkning på Europeisk plan Overvåkning i Norge-MSIS

PBM 233 Mikrobiologi for farmasøyter

PBM 233 Mikrobiologi for farmasøyter PBM 233 Mikrobiologi for farmasøyter Faglærer 2004: Per Arne Risøen Biologisk seksjon, ZEB Kap. 11 Mikrobiell evolusjon og systematikk Dateringer av fossiler viser at bakterier oppstod for ca. 3,6 milliarder

Detaljer

Vegard Eldholm. Molekylær TB epidemiologi

Vegard Eldholm. Molekylær TB epidemiologi Vegard Eldholm Molekylær TB epidemiologi Molekylærepidemiologiske metoder Sannsynliggjøre eller avkrefte transmisjonslinker mellom TB pasienter. Avdekke krysskontaminasjon i laboratoriet Skille reinfeksjon

Detaljer

Clostridium difficile

Clostridium difficile 1 Clostridium difficile nettundervisning 13.06.2013 Annette Onken Avdeling for medisinsk mikrobiologi Bærum sykehus - VVHF 2 Clostridium difficile Mikrobiologi, patogenese Epidemiologi Diagnostikk, særlig

Detaljer

CLOSTRIDIUM DIFFICILE OG SMITTEVERN

CLOSTRIDIUM DIFFICILE OG SMITTEVERN CLOSTRIDIUM DIFFICILE OG SMITTEVERN 19. 20. og 27. april 2016 Torunn Nygård Smittevernlege OUS Ullevål CLOSTRIDIUM DIFFICILE Gram positiv, anaerob stav Sporedanner Isolert første gang i 1935, Hall & O`Toole

Detaljer

Framtidstrender innen mikrobiologi. Fredrik Müller Mikrobiologisk avdeling, Oslo universitetssykehus HF

Framtidstrender innen mikrobiologi. Fredrik Müller Mikrobiologisk avdeling, Oslo universitetssykehus HF Framtidstrender innen mikrobiologi Fredrik Müller Mikrobiologisk avdeling, Oslo universitetssykehus HF 1 Dette vil jeg si noe om: 1. Samfunnsmessige trender i. Befolkningstall ii. Alderssammensetning iii.

Detaljer

Påvisning av resistensmekanismer ved hjelp av MALDI-TOF massespektrometri

Påvisning av resistensmekanismer ved hjelp av MALDI-TOF massespektrometri Påvisning av resistensmekanismer ved hjelp av MALDI-TOF massespektrometri André Ingebretsen Avd. for smittevern og Avd. for mikrobiologi Oslo Universitetssykehus NordicAST workshop 2012, Gøteborg MALDI-TOF

Detaljer

Genetic characterisation of Flavobacterium psychrophilum isolates from Norway and Chile

Genetic characterisation of Flavobacterium psychrophilum isolates from Norway and Chile Genetic characterisation of Flavobacterium psychrophilum isolates from Norway and Chile Patricia Apablaza Fiskesykdomsgruppen Institutt for biologi Universitet i Bergen FriskFisk konferanse Bergen, februar

Detaljer

Seksualatferd og klamydia blant elever i videregående skole i Finnmark 1

Seksualatferd og klamydia blant elever i videregående skole i Finnmark 1 Seksualatferd og klamydia blant elever i videregående skole i Finnmark 1 Bakgrunn Klamydia: vanligste seksuelt overført infeksjonen i Norge 22 500 tilfeller i 2011 Finnmark har gjennom mange år ligget

Detaljer

Multinasjonalt utbrudd av Salmonella Enteritidisi Europa. Lin Thorstensen Brandal Avd. for smitte fra mat, vann og dyr Nasjonalt folkehelseinstitutt

Multinasjonalt utbrudd av Salmonella Enteritidisi Europa. Lin Thorstensen Brandal Avd. for smitte fra mat, vann og dyr Nasjonalt folkehelseinstitutt Multinasjonalt utbrudd av Salmonella Enteritidisi Europa Lin Thorstensen Brandal Avd. for smitte fra mat, vann og dyr Nasjonalt folkehelseinstitutt Nasjonal referansefunksjon for næringsmiddelbårne bakterier

Detaljer

Vankomycinresistente enterokokker VRE Epidemiologi/utbruddet på Haukeland Universitetssjukehus

Vankomycinresistente enterokokker VRE Epidemiologi/utbruddet på Haukeland Universitetssjukehus Vankomycinresistente enterokokker VRE Epidemiologi/utbruddet på Haukeland Universitetssjukehus Kristin Stenhaug Kilhus LIS, Mikrobiologisk avdeling Haukeland Universitetssykehus 2 Enterokokker Gram positive

Detaljer

Streptococcus agalactiae. Andreas Radtke overlege Nasjonal referanselaboratorium for gruppe B streptokokker

Streptococcus agalactiae. Andreas Radtke overlege Nasjonal referanselaboratorium for gruppe B streptokokker Streptococcus agalactiae Andreas Radtke overlege Nasjonal referanselaboratorium for gruppe B streptokokker 1 Streptococcus agalactiae S.agalactiae eneste streptokokken som agglutinerer gruppe B antistoffer

Detaljer

Antibiotikabruk og mikrobielle økologiske effekter

Antibiotikabruk og mikrobielle økologiske effekter Antibiotikabruk og mikrobielle økologiske effekter Ragnhild Raastad Oslo universitetssykehus Disposisjon I. Introduksjon II. a. Hva er økologi? b. Normalflora Antibiotikabruk og resistens a. Internasjonalt

Detaljer

ÅRSRAPPORT fra. Nasjonalt referanselaboratorium for Streptococcus agalactiae

ÅRSRAPPORT fra. Nasjonalt referanselaboratorium for Streptococcus agalactiae ÅRSRAPPORT 2012 fra Nasjonalt referanselaboratorium for Streptococcus agalactiae Avdeling for medisinsk mikrobiologi, St. Olavs Hospital Besøksadresse: Erling Skjalgsons gate 1 Postadresse: St. Olavs Hospital,

Detaljer

MOLEKYLÆR EPIDEMIOLOGI

MOLEKYLÆR EPIDEMIOLOGI MOLEKYLÆR EPIDEMIOLOGI Mikrobiologiske metoder for undersøkelse av utbrudd av infeksjonssykdommer Kåre Bergh Avdeling for mikrobiologi, St.Olavs Hospital Institutt for laboratoriemedisin, barne- og kvinnesykdommer,

Detaljer

Anthrax, beredskap, varsling, erfaringer m.m.

Anthrax, beredskap, varsling, erfaringer m.m. Anthrax, beredskap, varsling, erfaringer m.m. Ingeborg S. Aaberge Avdeling for bakteriologi og infeksjonsimmunologi Nasjonalt folkehelseinstitutt Beredskapskonferanse 2009 Bacillus anthracis Årsak til

Detaljer

Laboratoriemedisinsk klinikk Avdeling for medisinsk mikrobiologi ÅRSRAPPORT fra. Nasjonalt referanselaboratorium for Streptococcus agalactiae

Laboratoriemedisinsk klinikk Avdeling for medisinsk mikrobiologi ÅRSRAPPORT fra. Nasjonalt referanselaboratorium for Streptococcus agalactiae Laboratoriemedisinsk klinikk Avdeling for medisinsk mikrobiologi ÅRSRAPPORT 2013 fra Nasjonalt referanselaboratorium for Streptococcus agalactiae Postadresse: St. Olavs Hospital HF, Sentral stab, Fagavdelingen,

Detaljer

ÅRSRAPPORT fra. Nasjonalt referanselaboratorium for Streptococcus agalactiae

ÅRSRAPPORT fra. Nasjonalt referanselaboratorium for Streptococcus agalactiae ÅRSRAPPORT 2011 fra Nasjonalt referanselaboratorium for Streptococcus agalactiae Avdeling for medisinsk mikrobiologi, St. Olavs Hospital Besøksadresse: Erling Skjalgsons gate 1 Postadresse: St. Olavs Hospital,

Detaljer

Bruk av DNA-sekvensering i mikrobiologisk diagnostikk. Øyvind Kommedal Haukeland Universitetssykehus

Bruk av DNA-sekvensering i mikrobiologisk diagnostikk. Øyvind Kommedal Haukeland Universitetssykehus Bruk av DNA-sekvensering i mikrobiologisk diagnostikk Øyvind Kommedal Haukeland Universitetssykehus Hvordan sekvensering revolusjonerte mikrobiologien Bakterienes morfologi Fenotypisk identifikasjon Fylogentisk

Detaljer

Aminoglykosidresistensi Enterobacteriaceae påvisning og molekylær epidemiologi

Aminoglykosidresistensi Enterobacteriaceae påvisning og molekylær epidemiologi Aminoglykosidresistensi Enterobacteriaceae påvisning og molekylær epidemiologi NORM-dagen 10. november 2011 Bjørg C. Haldorsen Innhold Aminoglykosider Aminoglykosidresistens Bakgrunn og formål Materiale

Detaljer

Brukerundersøkelsen 2015

Brukerundersøkelsen 2015 Brukerundersøkelsen 15 Brukerundersøkelsen 15 Gjennomført mai/juni 15 NORM-ansvarlig lege og bioingeniør v/ 22 medisinsk mikrobiologiske laboratorier i Norge ble invitert til å delta spørsmål i Questback-format

Detaljer

Strategimøte nr 14, 2000: STAFYLOKOKKER

Strategimøte nr 14, 2000: STAFYLOKOKKER Strategimøte nr 14, 2000: STAFYLOKOKKER Rapport fra strategimøte nr 14 Avdeling for bakteriologi Statens institutt for folkehelse, 2000 EKSTERNE KVALITETSVURDERINGER I BAKTERIOLOGI, MYKOLOGI OG PARASITTOLOGI

Detaljer

VRE-utbrudd ved St.Olavs Hospital Vancomycinresistente enterokokker. Smittevern St. Olavs Hospital HF

VRE-utbrudd ved St.Olavs Hospital Vancomycinresistente enterokokker. Smittevern St. Olavs Hospital HF VRE-utbrudd ved St.Olavs Hospital Vancomycinresistente enterokokker Marthe Lind Kroknes Spesialbioingeniør Andreas Radtke Smittevernlege Smittevern St. Olavs Hospital HF Enterokokker Enterokokker er i

Detaljer

EHEC-situasjonen i Norge smitteverntiltak ved enkelttilfeller og under utbrudd

EHEC-situasjonen i Norge smitteverntiltak ved enkelttilfeller og under utbrudd EHEC-situasjonen i Norge smitteverntiltak ved enkelttilfeller og under utbrudd Katrine Borgen Avdeling for infeksjonsovervåkning Nasjonalt folkehelseinstitutt November 2013 Overvåkning av EHEC og HUS EHEC:

Detaljer

Forskningsprosjekter på Sørlandet sykehus HF. Unn Ljøstad og Åslaug R. Lorentzen Nevrologisk avdeling

Forskningsprosjekter på Sørlandet sykehus HF. Unn Ljøstad og Åslaug R. Lorentzen Nevrologisk avdeling Forskningsprosjekter på Sørlandet sykehus HF Unn Ljøstad og Åslaug R. Lorentzen Nevrologisk avdeling ÅPENT MØTE OM DIAGNOSTIKK AV LYME BORRELIOSE 16.NOVEMBER 2013 Sørlandet sykehus har forsket på Epidemiologi

Detaljer

C. DIFF QUIK CHEK COMPLETE. Få hele det diagnostiske bildet med bare én test. TRYKK HER FOR Å SE NESTE SIDE

C. DIFF QUIK CHEK COMPLETE. Få hele det diagnostiske bildet med bare én test. TRYKK HER FOR Å SE NESTE SIDE C. DIFF QUIK CHEK COMPLETE Få hele det diagnostiske bildet med bare én test. TRYKK HER FOR Å SE SIDE KLINIKER Vil anvendelige C. difficiletestresultater på under 30 minutter bedre pasientbehandlingen?

Detaljer

AVL MOT ILA. FHFs ILA workshop Borghild Hillestad April 2017

AVL MOT ILA. FHFs ILA workshop Borghild Hillestad April 2017 AVL MOT ILA FHFs ILA workshop Borghild Hillestad April 2017 HVA BOR I GENOMET TIL EN ART? Det genetiske mangfoldet hos en art kan være enormt MENNESKER KAN STYRE GENETIKKEN I FLERE RETNINGER En negativ

Detaljer

MRSA. Antibiotikaresistens i husdyrbruket, Gardermoen 27.-28. mai 2015

MRSA. Antibiotikaresistens i husdyrbruket, Gardermoen 27.-28. mai 2015 MRSA Antibiotikaresistens i husdyrbruket, Gardermoen 27.-28. mai 2015 Carl Andreas Grøntvedt, Dipl. ECPHM Svinehelseansvarlig Veterinærinstituttet Postboks 750 Sentrum 0106 Oslo Tel: 23 21 63 87 Mob: 91

Detaljer

MRSA referanselaboratorium 2008

MRSA referanselaboratorium 2008 Oppsummering 2008 var første året Nasjonalt referanselaboratorium for MRSA, St. Olavs Hospital, Trondheim, systematisk og fortløpende fikk tilsendt isolater fra nyoppdagede MRSA positive personer fra alle

Detaljer

Oppsummering. Aktiviteter. Resultater. MRSA referanselaboratorium 2007

Oppsummering. Aktiviteter. Resultater. MRSA referanselaboratorium 2007 Oppsummering Referanselaboratoriumet har etablert rutinemessig spa-typing på alle isolater tilsendt i 2007 i tillegg til pulsfelt gelelektroforese (PFGE). Undersøkelse i forhold til Panton Valentine Leukocidin

Detaljer

Oslo universitetssykehus HF

Oslo universitetssykehus HF Oslo universitetssykehus HF Styresak Dato møte: 25. september 2015 Saksbehandler: Viseadm. dir. Medisin Helsefag og utvikling Vedlegg: SAK 59/2015 ANTIBIOTIKARESISTENS VED OSLO UNIVERSITETSSYKEHUS HF Forslag

Detaljer

Clostridium Difficile - Meldingsbeskrivelse for kommaseparert filformat

Clostridium Difficile - Meldingsbeskrivelse for kommaseparert filformat Nasjonalt folkehelseinstitutt IT og ehelse avdelingen Clostridium difficile Clostridium Difficile - Meldingsbeskrivelse for kommaseparert filformat INTRODUKSJON... 2 1.1 OM DOKUMENTET... 2 1.2 AVGRENSNINGER...

Detaljer

Styring av antibiotikabruk i sykehus INGRID SMITH, OVERLEGE/ 1. AMAN. KAS, FOU- AVD, HELSE-BERGEN/ KLIN. INST. 2, UIB

Styring av antibiotikabruk i sykehus INGRID SMITH, OVERLEGE/ 1. AMAN. KAS, FOU- AVD, HELSE-BERGEN/ KLIN. INST. 2, UIB Styring av antibiotikabruk i sykehus INGRID SMITH, OVERLEGE/ 1. AMAN. KAS, FOU- AVD, HELSE-BERGEN/ KLIN. INST. 2, UIB Transplantasjon Prematur Intensiv Kreft Protese Brannskade Antibiotikagrupper norske

Detaljer

ÅRSRAPPORT for 2013 fra

ÅRSRAPPORT for 2013 fra ÅRSRAPPORT for 2013 fra Nasjonalt referanselaboratorium for MRSA Avdeling for medisinsk mikrobiologi, St. Olavs Hospital Besøksadresse: Erling Skjalgssons gate 1 Postadresse: St. Olavs Hospital, 7006 Trondheim

Detaljer

Oversikt over tidligere nettundervisninger

Oversikt over tidligere nettundervisninger 2012 Oversikt over tidligere nettundervisninger 20.07.12 30.05.12 09.05.11 Enerom, et smitte- og sykdomsforebyggende tiltak i sykehus? Hygienesykepleier Anita Wang Børseth St. Olavs Hospital 18.04.12 Challanges

Detaljer

NGS (Neste Generasjons Sekvensering) i diagnostikk, erfaringer og resultater

NGS (Neste Generasjons Sekvensering) i diagnostikk, erfaringer og resultater NGS (Neste Generasjons Sekvensering) i diagnostikk, erfaringer og resultater Emiel Janssen Seksjonsleder for Kvantitativ og Molekylær Patologi Daglig leder for laboratoriet for molekylær biologi Avdeling

Detaljer

Akutte hendelser innen smittevernet. Oppdage, varsle og oppklare. Systemer for å: Georg Kapperud

Akutte hendelser innen smittevernet. Oppdage, varsle og oppklare. Systemer for å: Georg Kapperud Akutte hendelser innen smittevernet Systemer for å: Oppdage, varsle og oppklare Georg Kapperud Hva er en akutt hendelse? Sykdomsutbrudd eller et enkelttilfeller av alvorlig, smittsom sykdom Utbrudd Flere

Detaljer

Aminoglykosidresistens hos Enterobacteriaceae

Aminoglykosidresistens hos Enterobacteriaceae Aminoglykosidresistens hos Enterobacteriaceae NordicAST workshop 2012 Bjørg Haldorsen K-res Universitetssykehuset Nord-Norge Antibakteriell virkningsmekanisme Yttermembranen Erstatter Mg 2+ and Ca 2+ som

Detaljer

Bærerskap av ESBL blant Tromsøs befolkning

Bærerskap av ESBL blant Tromsøs befolkning Bærerskap av ESBL blant Tromsøs befolkning Samt bærerskap av Klebsiella pneumoniae Masterprosjekt 2015-2017 Lotte Leonore Eivindsdatter Andreassen UiT(IMB)/UNN (K-res) Begrepsavklaring β-laktamase = enzym

Detaljer

Antibiotikaresistens. Kristin Stenhaug Kilhus Mikrobiologisk avdeling Haukeland Universitetssykehus

Antibiotikaresistens. Kristin Stenhaug Kilhus Mikrobiologisk avdeling Haukeland Universitetssykehus Antibiotikaresistens Kristin Stenhaug Kilhus Mikrobiologisk avdeling Haukeland Universitetssykehus Hva er antibiotikaresistens? Antibiotikaresistens En mikrobes evne til å motstå virkningen av antibiotika

Detaljer

Pasientnær testing av infeksjonssykdommer

Pasientnær testing av infeksjonssykdommer Pasientnær testing av infeksjonssykdommer André Ingebretsen Avdeling for mikrobiologi og Avdeling for smittevern Oslo universitetssykehus Avdeling for smittevern, OUS Kompetansesenter for smittevern i

Detaljer

Meldingspliktige resistente bakterier og C. difficile

Meldingspliktige resistente bakterier og C. difficile Rapport kvartal 2/2013 Meldingspliktige resistente bakterier og C. difficile Folkehelseinstituttet vil fremover publisere kvartalsvise rapporter om forekomst av infeksjon og bæreskap forårsaket av utvalgte

Detaljer

Muligheter og begrensninger med genotypisk påvisning av resistens DAGENS ARBEIDSFLYT. Whole genome sequencing (WGS) 19.11.2014

Muligheter og begrensninger med genotypisk påvisning av resistens DAGENS ARBEIDSFLYT. Whole genome sequencing (WGS) 19.11.2014 Muligheter og begrensninger med genotypisk påvisning av resistens TØ-28244 Antibakterielle resistensmekanismer, metoder for påvisning, tolkning og klinisk betydning Tromsø, 20.11.14 Arnfinn Sundsfjord

Detaljer

Enerom, et smitte- og sykdomsforebyggende tiltak i sykehus?

Enerom, et smitte- og sykdomsforebyggende tiltak i sykehus? Enerom, et smitte- og sykdomsforebyggende tiltak i sykehus? - En deskriptiv retrospektiv epidemiologisk studie Master of Public Health (Godkjent NHV 23. September 2011) Anita Wang Børseth Regional smittevernrådgiver

Detaljer

Nøyaktig og presis? Er vi skikket til å utføre resistensbestemmelse? Årlig kvalitetskontroll av bioingeniører.

Nøyaktig og presis? Er vi skikket til å utføre resistensbestemmelse? Årlig kvalitetskontroll av bioingeniører. Nøyaktig og presis? Er vi skikket til å utføre resistensbestemmelse? Årlig kvalitetskontroll av bioingeniører. Astrid Lia Fagansvarlig for resistensbestemmelse Mikrobiologisk avdeling, Sykehuset i Vestfold

Detaljer

Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser

Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser PEDENDO_SISTE_slutt.qxd 18.12.2003 21:34 Side 32 Pediatrisk Endokrinologi 2003;17: 34-38 Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser Pål Rasmus Njølstad 1,2,3,Jørn V. Sagen

Detaljer

LA-MRSA. Estimert at over 60% av kommende menneskepatogene bakterier stammer fra dyr. Cutler, Emerging Infect Dis 2010 NATURE VOL 499 25 JULY 2013

LA-MRSA. Estimert at over 60% av kommende menneskepatogene bakterier stammer fra dyr. Cutler, Emerging Infect Dis 2010 NATURE VOL 499 25 JULY 2013 LA-MRSA NATURE VOL 499 25 JULY 2013 Estimert at over 60% av kommende menneskepatogene bakterier stammer fra dyr 1 Cutler, Emerging Infect Dis 2010 LA-MRSA S.aureus med meca/ mecc gen nytt penicillinbindende

Detaljer

Nasjonalt referanselaboratorium for humant papillomavirus (HPV)

Nasjonalt referanselaboratorium for humant papillomavirus (HPV) Nasjonalt referanselaboratorium for humant papillomavirus (HPV) Seksjon for forskning og utvikling, Avdeling for mikrobiologi og smittevern, 1478 Lørenskog Årsrapport 2013 HPV referansefunksjonen er organisert

Detaljer

ESBL. Anna Senske Lege Avdeling for smittevern 19. 20 og 27. april 2016

ESBL. Anna Senske Lege Avdeling for smittevern 19. 20 og 27. april 2016 ESBL Anna Senske Lege Avdeling for smittevern 19. 20 og 27. april 2016 April 2016 Inndeling Hva er ESBL? Forekomsten av ESBL ESBL-spredning ESBL-bærerskap Betydning av ESBL på sykehuset Terapi og sanering

Detaljer

Har vi resistensproblemer i medisinsk mykologi i Norge?

Har vi resistensproblemer i medisinsk mykologi i Norge? 1 Har vi resistensproblemer i medisinsk mykologi i Norge? Årskonferansen 01.12.2016 Cecilie Torp Andersen overlege Avdeling for mikrobiologi OUS Soppinfeksjoner og antimykotika Overfladiske infeksjoner

Detaljer

Bruk av statistikkfunksjonen i MLx. Overlege Dagfinn Skaare Mikrobiologisk avdeling Sykehuset i Vestfold HF 27.05.2010

Bruk av statistikkfunksjonen i MLx. Overlege Dagfinn Skaare Mikrobiologisk avdeling Sykehuset i Vestfold HF 27.05.2010 Bruk av statistikkfunksjonen i MLx Overlege Dagfinn Skaare Mikrobiologisk avdeling Sykehuset i Vestfold HF 27.05.2010 Agenda Eksempler på bruksområder Utvelging og lagring av data Bearbeiding og presentasjon

Detaljer

Antibiotikaresistens i husdyrproduksjonen med hovedvekt på MRSA og ESBL hva vet vi? Marianne Sunde 29. januar 2015

Antibiotikaresistens i husdyrproduksjonen med hovedvekt på MRSA og ESBL hva vet vi? Marianne Sunde 29. januar 2015 Antibiotikaresistens i husdyrproduksjonen med hovedvekt på MRSA og ESBL hva vet vi? Marianne Sunde 29. januar 2015 Antibiotika stoffer som dreper eller inaktiverer bakterier http://lumibyte.eu/medical/antibiotic-resistance-timeline/

Detaljer

Håndtering av ESBL i sykehjem. Tore W Steen 21.04.2015

Håndtering av ESBL i sykehjem. Tore W Steen 21.04.2015 Håndtering av ESBL i sykehjem Tore W Steen 21.04.2015 ESBL-holdige bakterier Extended Spectrum BetaLactamase Hovedtyper: - ESBL A(mbler) - ESBL M(iscellaneous) - ESBL CARBA ESBL A, ESBL M resistente mot

Detaljer

Meldingspliktige resistente bakterier og C. difficile

Meldingspliktige resistente bakterier og C. difficile Rapport kvartal 4/2013 Meldingspliktige resistente bakterier og C. difficile Folkehelseinstituttet publiserer kvartalsvise rapporter om forekomst av infeksjon og bæreskap forårsaket av utvalgte resistente

Detaljer

Populasjonsgenomikk på torsk -et verktøy for identifisering av viktige genomiske regioner for oppdrettsnæringen.

Populasjonsgenomikk på torsk -et verktøy for identifisering av viktige genomiske regioner for oppdrettsnæringen. Programkonferansen HAVBRUK 2012, Stavanger, 16.-18. april 2012 Populasjonsgenomikk på torsk -et verktøy for identifisering av viktige genomiske regioner for oppdrettsnæringen. Paul R. Berga, Bastiaan Stara,

Detaljer

Arabidopsis thaliana, vårskrinneblom

Arabidopsis thaliana, vårskrinneblom Arabidopsis thaliana, vårskrinneblom Tilhører Brassicaceae familien og ligger under ordenen Capparales. Nært beslektede planter er f. eks. raps og kål. Arabidopsis thaliana har i flere år vært en av modell

Detaljer

Årsrapport 2006. Nasjonalt referanselaboratorium for MRSA

Årsrapport 2006. Nasjonalt referanselaboratorium for MRSA Årsrapport 00 Nasjonalt referanselaboratorium for MRSA Oppsummering St. Olavs Hospital (StO) ved Avdeling for medisinsk mikrobiologi (AMM), ble høsten 00 oppnevnt som nasjonalt referanselaboratorium for

Detaljer

ÅRSRAPPORT for 2012. fra. Nasjonalt referanselaboratorium for MRSA

ÅRSRAPPORT for 2012. fra. Nasjonalt referanselaboratorium for MRSA ÅRSRAPPORT for 2012 fra Nasjonalt referanselaboratorium for MRSA Avdeling for medisinsk mikrobiologi, St. Olavs Hospital Besøksadresse: Erling Skjalgssons gate 1 Postadresse: St. Olavs Hospital, 7006 Trondheim

Detaljer

NFR : Avansert overvåking av introdusert krepsepest (Aphanomyces astaci) for bedre forvaltning av truet ferskvannskreps

NFR : Avansert overvåking av introdusert krepsepest (Aphanomyces astaci) for bedre forvaltning av truet ferskvannskreps NFR-183986 : Avansert overvåking av introdusert krepsepest (Aphanomyces astaci) for bedre forvaltning av truet ferskvannskreps Prosjektleder: Trude Vrålstad Prosjektstipendiat: David Strand Veterinærinstituttet

Detaljer

Antibiotikaresistens og antibiotikapolitikk i kommunene. Andreas Radtke Smittevernoverlege, PhD St.Olavs Hospital

Antibiotikaresistens og antibiotikapolitikk i kommunene. Andreas Radtke Smittevernoverlege, PhD St.Olavs Hospital Antibiotikaresistens og antibiotikapolitikk i kommunene Andreas Radtke Smittevernoverlege, PhD St.Olavs Hospital 1 2 Works Progress Administration, 1936 From: Trends in Infectious Disease Mortality in

Detaljer

Masterspesialiseriger innen LUN

Masterspesialiseriger innen LUN 1 Masterspesialiseriger innen LUN Masterspesialisering i matematikk - anvendt matematikk m/fysikk - anvendt matematikk m/kjemi Masterspesialisering i fysikk - fornybar energifysikk - biologisk fysikk Masterspesialisering

Detaljer

Spesielle problembakterier begreper, forkortelser og smittevernmessig relevans

Spesielle problembakterier begreper, forkortelser og smittevernmessig relevans Spesielle problembakterier begreper, forkortelser og smittevernmessig relevans Nettundervisning for smittevernpersonell i Helse Sør 15.september 2010 Per Bjark,smittevernlege,Sykehuset i Vestfold, Tønsberg

Detaljer

Nyfødtintensivutbrudd 2016 Helse Stavanger HF. Lars Kåre Kleppe smittevernlege, Stavanger

Nyfødtintensivutbrudd 2016 Helse Stavanger HF. Lars Kåre Kleppe smittevernlege, Stavanger Nyfødtintensivutbrudd 2016 Helse Stavanger HF Lars Kåre Kleppe smittevernlege, Stavanger Innledning Mellom 300 og 400 barn fødes årlig i Norge som ekstremt premature med vekt under 1000 g og/eller svangerskapsuke

Detaljer

GLYKOPEPTID- RESISTENS HOS ENTEROKOKKER

GLYKOPEPTID- RESISTENS HOS ENTEROKOKKER GLYKOPEPTID- RESISTENS HOS ENTEROKOKKER KRISTIN HEGSTAD INNHOLD Enterokokker Utvikling og spredning av resistens hos enterokokker van cluster spredning Persistens Peptidoglykan oppbygging repetisjon Glykopeptidantibiotika

Detaljer

Foredlingsmetoden fra plusstreutvalg og avkomtesting til molekylær genetikk! Øystein Johnsen, Skog og landskap

Foredlingsmetoden fra plusstreutvalg og avkomtesting til molekylær genetikk! Øystein Johnsen, Skog og landskap Foredlingsmetoden fra plusstreutvalg og avkomtesting til molekylær genetikk! Øystein Johnsen, Skog og landskap St.meld. nr. 39; Klimautfordringene Regjeringen mener økt innsats i skogplanteforedlingen

Detaljer

RESISTENSPROBLEMATIKK. Pål A. Jenum. september 2015

RESISTENSPROBLEMATIKK. Pål A. Jenum. september 2015 RESISTENSPROBLEMATIKK Pål A. Jenum september 2015 1 Hva er resistens? Motstandskraft mot ytre påvirkning Mikrober antibiotika desinfeksjonsmidler 2 Hva er naturlig resistens? Iboende egenskaper: Villtype

Detaljer

SCREENING AV VRE OG ESBL

SCREENING AV VRE OG ESBL SCREENING AV VRE OG ESBL Laboratoriediagnostikk Anja Hannisdal Kvalitetskoordinator Sykehuset i Vestfold, Mikrobiologisk avdeling Anja Hvorfor screening av VRE? Forekomsten av vankomycinresistente enterokokker

Detaljer

Overvå kning åv resistente båkterier Årsrapport

Overvå kning åv resistente båkterier Årsrapport Overvå kning åv resistente båkterier Årsrapport 2015 1 Avdeling for infeksjonsovervåking Epost: she@fhi.no www.fhi.no/tema/antibiotikaresistens FHI: Oliver Kacelnik, Elisabeth Astrup, Jørgen V. Bjørnholt

Detaljer

Undervisning på Dialysen 27/2

Undervisning på Dialysen 27/2 Undervisning på Dialysen 27/2 Anaerob sporedannende bakterie Tilhører tykktarmens normalflora hos 5 10 % av oss (50% hos spedbarn, 2 3% hos voksne) Bakterien dør fort utenfor tarmen, men sporene utskilles

Detaljer

Last ned Innføring i mikrobiologi - Arne Tronsmo. Last ned

Last ned Innføring i mikrobiologi - Arne Tronsmo. Last ned Last ned Innføring i mikrobiologi - Arne Tronsmo Last ned Forfatter: Arne Tronsmo ISBN: 9788215025926 Antall sider: 383 Format: PDF Filstørrelse:15.01 Mb Endelig kommer en norsk grunnbok i mikrobiologi.

Detaljer

Kap.2 Sentrale begreper og definisjoner 1

Kap.2 Sentrale begreper og definisjoner 1 Kap.2 Sentrale begreper og definisjoner 1 Sentrale begreper og definisjoner Antibiotikaassosiert diaré colitt forårsaket av antibiotikabehandling, hvor bakterien Clostridium difficile produserer toksiner

Detaljer

Master. Biologi (BIOL)

Master. Biologi (BIOL) UMB, Institutt for plante- og miljøvitenskap Master i Biologi (BIOL) H:studieplaner/2009_2010/MasterBiologi Master Biologi (M-BIOL) Mastergraden er på 120 studiepoeng (sp). 70 sp er obligatoriske for alle,

Detaljer

Hva mener vi med Emerging. En introduksjon

Hva mener vi med Emerging. En introduksjon Fagtreff 28. januar 2008 Hva mener vi med Emerging Pathogens? En introduksjon Øyvin Østensvik Norges veterinærhøgskole Institutt for Mattrygghet og Infeksjonsbiologi Utgangspunkt Vi blir ikke kvitt smittestoffene

Detaljer

Antibiotikaresistens og resistensmekanismer

Antibiotikaresistens og resistensmekanismer Antibiotikaresistens og resistensmekanismer RELIS Fagseminar 290118 Overlege Hege Enger Avd. for medisinsk mikrobiologi St Olavs hospital Disposisjon Introduksjon Hva er antibiotikaresistens? Eksempler

Detaljer

PCR-analyser i rutinediagnostikken Pål A. Jenum

PCR-analyser i rutinediagnostikken Pål A. Jenum PCR-analyser i rutinediagnostikken Pål A. Jenum september 2015 1 Utvikling Antall genmolekylære analyser pr år (unntatt klamydia og gonokokker: Ca 32.000 i 2015) 120000 Stipulert for hele året 100000 80000

Detaljer

Resistensrapport for Sykehuset Innlandet 2016

Resistensrapport for Sykehuset Innlandet 2016 Resistensrapport for Sykehuset Innlandet Rapportmalen er utarbeidet av Seksjon for mikrobiologi og smittevern, Akershus universitetssykehus, brukt med tillatelse fra seksjonsoverlege Silje Bakken Jørgensen.

Detaljer

Smittevern sett fra veterinærsiden utfordringer framover

Smittevern sett fra veterinærsiden utfordringer framover Smittevern sett fra veterinærsiden utfordringer framover Nasjonal konferanse om antibiotikaresistens og infeksjoner i helsetjenesten, Gardermoen 11. november 2015 Anne Margrete Urdahl Smittevern hindre

Detaljer

Campylobacteriose et aktuelt problem. Kjetil K. Melby Mikrobiologisk avdeling Oslo universitetssykehus

Campylobacteriose et aktuelt problem. Kjetil K. Melby Mikrobiologisk avdeling Oslo universitetssykehus Campylobacteriose et aktuelt problem Kjetil K. Melby Mikrobiologisk avdeling Oslo universitetssykehus Temaliste Campylobacterjejuni/coli infeksjoner Epidemiologi Enkeltpasienter (Vannbårne) utbrudd (Norge)

Detaljer

Blomster i sykehus, fint eller farlig?

Blomster i sykehus, fint eller farlig? Nettundervisning i smittevern 26. september 2012 Blomster i sykehus, fint eller farlig? En litteraturgjennomgang Egil Lingaas, Liudmyla Fagerbakk og Mylene Rimando Avd. for smittevern Oslo universitetssykehus

Detaljer

AFA-kurs 2013 6. November OUS-Rikshospitalet

AFA-kurs 2013 6. November OUS-Rikshospitalet ESBL A & ESBL M-C AFA-kurs 2013 6. November OUS-Rikshospitalet Ørjan Samuelsen, Forsker Kompetansetjeneste for påvisning av antibiotikaresistens (K-res) Avd. for mikrobiologi og smittevern Universitetssykehuset

Detaljer

Rapportering av antibiotikabruk og resistens

Rapportering av antibiotikabruk og resistens Rapportering av antibiotikabruk og resistens per.akselsen@helse-bergen.no Per Espen Akselsen Nasjonal kompetansetjeneste for antibiotikabruk i spesialisthelsetjenesten FoU-avd, Haukeland Universitetssykehus

Detaljer

Håndhygiene. - hvorfor, hvor, når og hvordan. Praktisk smittevern i primærhelsetjenesten Sandefjord, 5. november 2013

Håndhygiene. - hvorfor, hvor, når og hvordan. Praktisk smittevern i primærhelsetjenesten Sandefjord, 5. november 2013 Håndhygiene - hvorfor, hvor, når og hvordan Praktisk smittevern i primærhelsetjenesten Sandefjord, 5. november 2013 Mette Fagernes Nasjonalt folkehelseinstitutt Utviklingssenter for sykehjem og hjemmetjenester,

Detaljer

Meldingspliktige resistente bakterier og C. difficile

Meldingspliktige resistente bakterier og C. difficile Rapport kvartal 3/2013 Meldingspliktige resistente bakterier og C. difficile Folkehelseinstituttet publiserer kvartalsvise rapporter om forekomst av infeksjon og bæreskap forårsaket av utvalgte resistente

Detaljer

LEKSJON 4: BIOTEKNOLOGI HVORDAN VI BRUKER NATURENS EGNE MEKANISMER TIL VÅR FORDEL, OG UTFORDRINGENE SOM FØLGER MED

LEKSJON 4: BIOTEKNOLOGI HVORDAN VI BRUKER NATURENS EGNE MEKANISMER TIL VÅR FORDEL, OG UTFORDRINGENE SOM FØLGER MED LEKSJON 4: BIOTEKNOLOGI HVORDAN VI BRUKER NATURENS EGNE MEKANISMER TIL VÅR FORDEL, OG UTFORDRINGENE SOM FØLGER MED KOMPETANSEMÅL Forklarebegrepene krysning og genmodifisering, og hvordan bioteknologi brukes

Detaljer

Overvåkning av MRSA i Norge Hva gjøres og hva finner vi. Kjersti Wik Larssen Nasjonalt referanselaboratorium for MRSA St.

Overvåkning av MRSA i Norge Hva gjøres og hva finner vi. Kjersti Wik Larssen Nasjonalt referanselaboratorium for MRSA St. Overvåkning av MRSA i Norge Hva gjøres og hva finner vi Kjersti Wik Larssen Nasjonalt referanselaboratorium for MRSA St. Olavs Hospital HF Innhold Kort om MRSA Historikk Kort om påvisning av MRSA Overvåkning

Detaljer

Last ned Innføring i mikrobiologi - Arne Tronsmo. Last ned

Last ned Innføring i mikrobiologi - Arne Tronsmo. Last ned Last ned Innføring i mikrobiologi - Arne Tronsmo Last ned Forfatter: Arne Tronsmo ISBN: 9788215025926 Antall sider: 383 Format: PDF Filstørrelse: 11.09 Mb Endelig kommer en norsk grunnbok i mikrobiologi.

Detaljer

Grunnleggende og anvendt biovitenskap. Are Halvor Aastveit IKBM

Grunnleggende og anvendt biovitenskap. Are Halvor Aastveit IKBM Grunnleggende og anvendt biovitenskap Are Halvor Aastveit IKBM Grunnleggende og anvendt biovitenskap Grunnleggende biovitenskap -Biologi -Økologi -Kjemi/biokjemi -Mikrobiologi -Genomikk -Kvantitativ analyse

Detaljer

ÅRSRAPPORT for 2011. fra. Nasjonalt referanselaboratorium for Francisella tularensis

ÅRSRAPPORT for 2011. fra. Nasjonalt referanselaboratorium for Francisella tularensis ÅRSRAPPORT for 2011 fra Nasjonalt referanselaboratorium for Francisella tularensis Avdeling for medisinsk mikrobiologi, St. Olavs Hospital Besøksadresse: Erling Skjalgsons gate 1 Postadresse: St. Olavs

Detaljer

Indekser i avlsarbeidet: Kan vi se om de virker? Jørgen Ødegård Avlsforsker

Indekser i avlsarbeidet: Kan vi se om de virker? Jørgen Ødegård Avlsforsker Indekser i avlsarbeidet: Kan vi se om de virker? Jørgen Ødegård Avlsforsker Gentisk fremgang Hver generasjon står på skulderne til forrige generasjon Fremgangen er varig Selv om avlsarbeidet skulle stoppe

Detaljer

Lost in Translation ESBL fra sykehus til kommune

Lost in Translation ESBL fra sykehus til kommune Lost in Translation ESBL fra sykehus til kommune Smittevernoverlege Bjørg T. Dysthe Bærum kommune NSH Hamar 15.10.14 ESBL egenskap Extended-spectrum beta-lactamases Enzym som bryter beta-lactamring i penicillin

Detaljer

Genkartlegging. Hva er egentlig et genkart? Genetisk og fysisk kartlegging

Genkartlegging. Hva er egentlig et genkart? Genetisk og fysisk kartlegging NTNU Genkartlegging 1 Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer Hva er egentlig et genkart? Kartet over det humane genom gir oss posisjonen av de ca 25,000 genene

Detaljer

MRSA-funn i sykehjem i Oslo 2005 111819 23

MRSA-funn i sykehjem i Oslo 2005 111819 23 Originalartikkel MRSA-funn i sykehjem i Oslo 2005 111819 23 BAKGRUNN Det siste tiåret har antallet MRSA-funn økt betydelig i Norge. Det er et mål at bakteriene ikke skal etablere seg i sykehjem og sykehus.

Detaljer

2.8 BACHELORGRADSPROGRAM I BIOMATEMATIKK

2.8 BACHELORGRADSPROGRAM I BIOMATEMATIKK 2.8 BACHELORGRADSPROGRAM I BIOMATEMATIKK SIDE 111 2.8 BACHELORGRADSPROGRAM I BIOMATEMATIKK 2.8.1 INNLEDNING Dette er et treårig studieprogram med emner fra matematikk, statistikk, biologi og medisin. Programmet

Detaljer

Arbeidet vil foregå sammen med forskere og ingeniører ved FFI og er egnet for både 30 og 60 poengs MSc oppgaver.

Arbeidet vil foregå sammen med forskere og ingeniører ved FFI og er egnet for både 30 og 60 poengs MSc oppgaver. MSc oppgave ved NTNU, 2011-2012 Genotyping av biologiske trusselstoffer Genotyping of biological threat agents Bioterrorisme, eller intensjonell spredning av sykdom, slik det ble utført i USA i 2001 viser

Detaljer

Avlsarbeid - luseresistens

Avlsarbeid - luseresistens Avlsarbeid - luseresistens Benchmark Breeding & Genetics - BBG Salmobreed Stofnfiskur AFGC Spring Genetics 2 Salmobreed Family based breeding program Started 2000, based on Bolaks and Jakta strains Index

Detaljer

Molekylærbiologi: Nøkkelen til alle levende organismer

Molekylærbiologi: Nøkkelen til alle levende organismer Molekylærbiologi: Nøkkelen til alle levende organismer Svein-Ole Mikalsen Náttúruvísindadeildin Megindeildin fyri náttúru- og heilsuvísindi Fróðskaparsetur Føroya Botanikk Zoologi Genetikk Mikrobiologi

Detaljer

FYS3710 Molekylærbiologi

FYS3710 Molekylærbiologi 1 2 I en eukaryot celle er kromosomene festet i en indre membran som omgir en kjerne. Proteinene produseres i cellens cytoplasma. 3 I en prokaryot celle (for eksempel en bakteriecelle) er det ett kromosom.

Detaljer

Immunstimulanter for potensiering av torskens naturlige immunsystem

Immunstimulanter for potensiering av torskens naturlige immunsystem Store programmer HAVBRUK - En næring i vekst Faktaark www.forskningsradet.no/havbruk Immunstimulanter for potensiering av torskens naturlige immunsystem Prosjekt: Immunostimulation of Atlantic cod (Gadus

Detaljer

ESBL Nye nasjonale anbefalinger fra FHI Fagdag for Smittevern November 2015

ESBL Nye nasjonale anbefalinger fra FHI Fagdag for Smittevern November 2015 ESBL Nye nasjonale anbefalinger fra FHI Fagdag for Smittevern November 2015 ESBL (extended spectrum betalactamase) ESBL=enzymer som produseres av visse gramnegative tarmbakterier. Bryter ned betalaktamantibiotika

Detaljer

Klipp og lim: Genredigering med CRISPR teknologi

Klipp og lim: Genredigering med CRISPR teknologi Klipp og lim: Genredigering med CRISPR teknologi Realfagskonferanse 4. mai 2017 Magnar Bjørås Institutt for kreftforskning og molekylærmedisin, NTNU Klinikk for laboratoriemedisin, Oslo Universitetssykehus

Detaljer

Persontilpasset medisin

Persontilpasset medisin Persontilpasset medisin Bjørn H. Grønberg Professor, Institutt for klinisk og molekylær medisin, NTNU Overlege, Kreftklinikken, St. Olavs Hospital Forebygging, diagnostikk, behandling og oppfølging tilpasset

Detaljer