Hvilke IT-tekniske (og andre) utfordringer stiller genteknologien helsevesenet overfor?

Størrelse: px
Begynne med side:

Download "Hvilke IT-tekniske (og andre) utfordringer stiller genteknologien helsevesenet overfor?"


1 Hvilke IT-tekniske (og andre) utfordringer stiller genteknologien helsevesenet overfor? dr.med. Hallvard Lærum, Stab IKT, Oslo Universitetssykehus Espen Skorve, Institutt for Informatikk, Universitetet i Oslo HelsIT, 18.septemer 2012

2 Bakgrunn Det er nå praktisk og økonomisk mulig å sekvensere alle genene hos en pasient ved hjelp av High Throughput Sequencing (HTS)-teknikker. Funnene fra slike undersøkelser danner grunnlag for såkalt individualisert medisin, og har konsekvenser for alt fra valg av behandling til hvilken risiko pasienten har for å bli syk. Få leger har tilstrekkelig kunnskap om disse omfattende funnene, og vi tror det er lite sannsynlig at helsepersonell vil kunne tilegne seg kunnskapen på egen hånd. Teknikken skaper en rekke tekniske, medisinske, etiske og juridiske utfordringer.

3 genap Tverrfaglig forskningsprosjekt støttet av Norges forskningsråd i VERDIKT-prosjektet Samarbeid mellom OUS og UiO Avd. for medisinsk genetikk OUS Stab IKT OUS Avd. for farmakologi OUS Norwegian Sequencing Center Inst. for informatikk UiO USIT Juridisk fakultet UiO

4 Mål for genap-prosjektet Utforme plattform for å lagre og tilgjengeliggjøre data fra sekvensering av hele pasientens arvemateriale Automatisering av analyseprosess fra rådata til genetiske funn Sørge for sikker lagring og tilgangsstyring etter gjeldende lover og forskrifter Støtte sikker formidling av genomdata nasjonalt Gi innspill til endring av bioteknologiloven ut fra kliniske behov demonstrert av plattformen Støtte bruk av genetiske data i klinisk praksis ved å formidle tolkninger av dem Prøve ut og tilpasse internasjonale innholdsstandarder for genetiske rapporter for integrasjon i elektronisk pasientjournal. Utvikle algoritmer for tolkning av genetiske funn innen diagnostikk og prognose, behandlingsanbefalinger (farmakogenomikk) og prediktive tester (risiko for sykdom)

5 Genetisk variasjon Hvert genom har 3.4 milliarder basepar ATTCATTCCATAGGCAAGTTATTATFGGC Hver person har millioner av varianter i sitt genom En stor andel genetiske varianter er ikke beskrevet før I gjennomsnitt har hver person 70 varianter (mutasjoner) som er helt nye, dvs. er verken arvet fra mor eller far I gjennomsnitt har hver person 100 loss of function varianter, som isolert sett burde gitt sykdom. Det gjør de ikke.

6 Hvilke deler av DNA blir analysert? Intron Ekson Intron Ekson Ekson Intron Eksom Fullgenom Targeted Reguleringsseter, Copy Number Variations (CNV), non-coding regions

7 Genetikk er relevant for alle pasienter Behandling Dosering av takrolimus (Prograf, Advagraf) ved organtransplantasjon Dosering av warfarin (Marevan) Dosering av nevroleptika Valg og dosering av betablokkere og kalsiumkanalblokkere Innsetting av Implantabel Cardioverter-Defibrillator (ICD) ved mistanke om arvelig hypertrofisk kardiomyopati Forenklet diagnostikk Hypertrofisk kardiomyopati Mental retardasjon hos barn Prognose Hypertrofisk kardiomyopati Huntington s chorea Risiko Arvelig risiko for brystkreft Type 2 Diabetes Schizofreni og bipolar manisk-depressiv lidelse

8 Marevan (Warfarin) Farlig legemiddel 21 pasienter døde på grunn av Marevan i Norge i 2011 (blødning) fikk resept på medikamentet i Genetisk styrt behandling gir riktigere dosering (1) NEJM 2009: Bedre tilpasset dosering ved bruk av genetiske data enn kliniske algoritmer eller fast dosering. Aktuelle genvarianter CYP2C9: Variantprevalensen for *2 og *3 er hhv. 10% og 6% hos hvite (kaukasiere) *1: normal warfarindosering *2: 30% reduksjon av metabolisme *3: 90% reduksjon av metabolisme VKORC1: A - allel gir lavere produksjon av VKORC1 enn G -allel, og dermed mindre behov for warfarin. 37% av hvite har A -allel Men: CYP4F2: rs varianten gir lavere CYP4F2 og dermed høyere nivå av vitamin K, dvs. større behov for warfarin. Tør vi gi marevan til pasienter med kombinasjonen CYP2C9*3 og VCORC1-A? Skal ha dramatisk redusert dosering (under 10%) Tør vi behandle pasienter med marevan uten å vite dette? (1) Estimation of the Warfarin Dose with Clinical and Pharmacogenetic Data. New England Journal of Medicine 360, no. 8 (February 19, 2009):

9 Takrolimus Legemiddel for organtransplantasjon Takrolimus er et immunsupprimerende legemiddel som brukes for å unngå frastøtning ved organtransplantasjon. Store forskjeller i metabolisme ut fra genetiske varianter Noen mennesker (ca.15%) har mye høyere metabolisme av takrolimus enn andre, og krever dobbelt så høy dose ved oppstart, dvs. like etter at nyren er transplantert inn. Flere gener er involvert, men sammenhengen er sterkest for CYP3A5-genet. *1- varianten (homozygot eller heterozygot) gir CYP3A5-uttrykk, og dermed økt metabolisme i forhold til den norske normalbefolkningen. Forskjellen kan bety liv og død Pasienter som ikke kommer raskt opp i ønsket legemiddelkonsentrasjon har økt risiko for frastøtning. De som har frastøtning tidlig etter transplantasjonen får hyppigere frastøtning senere, og har dårligere overlevelse. CYP3A5 vurderes innført som standard undersøkelse i den nasjonale tx-protokollen.

10 Svært effektiv genetisk utredning Genetiker eller legespesialist kan finne ethvert gen bare ved å slå opp i en database Hva er CYP3A5, CYP3A4 og POR? CYP3A5 *1/*3 CYP3A4 *18/*1b POR *28/*28 Genomdata

11 Hjelp til styring av behandling Hvordan doserer jeg Marevan for akkurat denne pasienten? Enkelt eksempel Et øyeblikk Bzzbzz.. CYP2C9..bzzbzz.. VCORKC1 Almenpraktiker Genomdata Bzzbzz.. CYP2C9*1..bzzbz z..vcorkc1*3

12 Hjelp til diagnostikk Noe mer komplisert eksempel Er dette den arvelige formen for kardiomyopati? Hei! Hjelp Et Den øyeblikk meg, varianten Kjære har jeg genetiker! aldri sett før! Bzzbzz.. MYH7..bzzbzz TNNT2..TPM1 Genomdata Almenpraktiker Hm stoppkodon Ok. midt i myomet, det kan umulig gå bra Bzzbzz.. MYH7..bzzbzz TNNT2..TPM1 Genetiker

13 ??!!!??!!! Men Jeg Ja Det liker tror er Så???! vi var får la det ikke ikke Ok. greit. det? stå fint! dette bra. til Pasient Kjære kunde! Vi har Kjære den jobbsøker. aller beste Vi Kjære kunde. Vi kvikksølv-salve har vurdert din som søknad, beklager og funnet at vi ikke kurerer akkurat din at du lenger nok ikke kan tilby aktuell deg hjertesvikt for denne livsforsikring. stillingen. Eller lån. Informasjonssikkerhet Genomdata Vil du vite om det Det kan tenkes at Jeg Sykehuset vårt Skal hvis vi vi bestille finner Flotte Men har det dårlige greier! er godt nyheter Nå fikk vi vet vi vi finner risiko for en til kan dette. deg. kartlegge Hjertesvikten alle slags risiko sykdom slik genomsekvensering? uhelbredelig for Da bestiller en forklaring Vi kan operere er jeg på som du av inn gener nå. Dette er ikke hjertesvikten pacemakeren alvorlig type. genomsekvensering medikamentet tiden inne, og vi det valgte vil din, når Den og visste om. kommer nyttig til for å forverre din sykdom? gi seg deg utredning, over de nærmeste virket beskyttelse jo og fint. for i lang å velge riktig årene. tid. behandling Men det var godt vi så Nei og nei. Denne det nå. Vi setter inn en type hjertesvikt slags pacemaker som klarer vi ikke å starter hjertet igjen hvis stoppe. det begynner å flimre Uærlig arbeidsgiver Almenpraktiker Utrolig Hei sånn Laila! uflaks For Hm Jeg jeg Huntington s manisk må er skaffe det noen har hatt på mer depressivitet,..hjertesvikt skal du få med penger ukjent i internett-poker en liste sykdom over det kanskje?... sykdomsrisiko..diabetes.. fart! DER! kunder Den er grei. du ikke siste. skal selge livsforsikring Legespesialist her da? til Uærlig selger Uærlig forsikringsagent Uærlig ansatt

14 Utfordringer

15 Tekniske utfordringer Middels store datamengder Ca.1 Gb per genom Tilsv. 20 CT eller 100 rtg.thorax Omfattende prosessering Ca t (104 døgn) per genom for diagnostikk for vanlige servere uten cluster-teknologi Krav til prosessering begrenser økning av pasientvolum mer enn krav til lagring Enkel formidling Få gener brukes i hver tolkning Identifisering av genvarianter krever tilgang til store databaser i stadig endring Knytning av hypersensitive data til databaser på internett er en sikkerhetsutfordring Svakheter i dagens datagrunnlag vil gi behov for å analysere undersøkelser på nytt i fremtiden Lagringsbehov Eksom 1.5 % av genomet Fullgenom Rådata 7 Gb 500 Gb Sekvensdata (komprimert FASTA) Varianter (ASCII 20 bytes/gen) Prosessering Forskning (BWA) Diagnostikk (NovoAlign) Antall unders. per år 14 Mb 950 Mb 500 Kb - Eksom 1.5 % av genomet 15 t 750 t Fullgenom 50 t 2500 t Samtidige CPU er 500 eksomer 71 7 Gb Lagringsbheov per år 500 genomer Gb

16 Medisinske utfordringer Få leger har oppdatert genetisk kunnskap med relevans for sitt fagfelt ut over diagnostikk Hovedvekten av genetiske undersøkelser fra amerikanske primærleger dreide seg om vordende foreldre med mistanke om å være bærere av sykdomsgener (Ronquillo et al 2012*) Individualisert medisin betyr at hver pasient må vurderes for seg, selv om de har samme diagnose Kritisk å få tilgang på kunnskap som er tilpasset hver enkelt pasient Tolkning av genetiske funn bør automatiseres og formidles dit leger tar beslutninger om utredning og behandling Tolkning er i økende grad avhengig av pålitelige og oppdaterte grunndata Vanlig forekommende varianter med sterke effekter er i hovedsak avdekket Ny kunnskap vil komme fra effekt av sjeldne varianter, eller kombinert effekt av flere varianter Kvaliteten på offentlig tilgjengelige databaser med genetisk kunnskap er variabel

17 Retten til ikke å vite Ikke alle vil takle en dårlig prognose Hva gjør vi med utilsiktede funn? Etiske utfordringer Retten til ikke å diskrimineres Risiko for å utvikle sykdom kan påvirke forhold til familie, arbeidsgiver, forsikringsselskap og andre Genomdata sier også noe om dine foreldres gener; hvem de er og hvor du kommer fra Retten til personvern, og potensiale for overvåkning Gensekvensene er så variable at selv kortere utdrag kan være unike for deg Genomdata kan brukes til å identifisere deg og til å se hvor du har vært Men også: retten til god helsehjelp Diagnostikk, forebygging og behandling kan forbedres betydelig med genetiske undersøkelser Det er uetisk å bli utsatt for bivirkninger eller uvirksom behandling hvis det kan unngås

18 Juridiske utfordringer Bioteknologiloven kap.5 Om prediktive undersøkelser Alle typer skal godkjennes av helsedepartmentet og bioteknologinemda Pasienten skal gi skriftlig samtykke til undersøkelsen Pasienten skal gis genetisk veiledning før, under og etter undersøkelsen Om genetiske masseundersøkelser og farmakogenetiske undersøkelser Kan godkjennes i forskrift, og kan gi unntak fra kravene over Konsekvens: Med mindre det gis unntak i forskrift, skal pasienten gi skriftlig samtykke for alle typer genetiske undersøkelser Kan pasienten gi blankofullmakt til et helt genom? Er hver ny tolkning av utvalgte gener i et genom en ny undersøkelse? Helseinformasjonssikkerhetsforskriften og lesing av informasjon på tvers av virksomheter Egne avtaler mellom virksomheter Skriftlig pasientsamtykke i hvert tilfelle av tilgang, men kan gis overfor hele virksomheter for en periode Logging av forespørsel om og resultat av tilgang

19 Ulike brukere trenger ulik tilgang på genetisk informasjon eksempel fra farmakogenetikk Sykepleier Trenger hint om at det genetiske årsaker til en uvanlig høy dosering, men ikke nødvendigvis detaljene fra undersøkelsen Primærlege Trenger praktisk råd om dosering av medikament med overordnet beskrivelse av mekanisme Legespesialist Trenger praktisk råd om dosering av medikament, med beskrivelse av mekanisme og presis angivelse av genvariant Genetiker, bioinformatiker, molekylærbiolog Trenger full tilgang til å søke på aktuelle og beslektede genvarianter med angivelse av klassifisering, analysekvalitet og rene sekvensdata. Praktiske råd og automatisert tolkning tas med som orienterende informasjon.

20 Kan vi skille på gener mtp. hvor stigmatiserende resultatene oppleves å være? Gener relevante for: Har betydning for: Stigmatiserende? Behandling Alt helsepersonell involvert i å yte behandlingen Nei, sjelden Diagnostikk Legespesialister Kan være det, men funnene er som regel ventet Sykdomsrisiko og prognose Genetikere Ja, ofte. Eks. psykiatriske tilstander, tilstander med stor funksjonssvikt Overlapp! Om brystkreftpasienter ikke kan omsette tamoxifen til aktiv form (CYP2D6), er prognosen dårligere Mange diagnostiske tester sier også noe om prognosen (for eksempel kardiomyopati, Huntington s sykdom). Hva med de som ikke vil vite prognosen om den er dårlig?

21 Utfordringer for kliniske IKT-systemer (1) Kompliserte krav til informasjonssikkerhet Tilgangsstyring til deler av pasientopplysningene ut fra rolle, tilsv. skjermet journal for psykiatri Håndtere pasientsamtykke og tilgang for relevant helsepersonell, samtidig med pasienters rett til ikke å vite Vil i praksis kreve bedre mekanismer for å formidle samtykke og bekreftelse av tjenestelig behov for tilgang enn vi har i dag Vanlig svarrapportering er ikke egnet Et mindre antall genvarianter (eks. CYP-genene) kan ha konsekvenser for et stort antall legemidler eller andre behandlingsformer Skal man liste opp legemidler på tampen av en svarrapport, eller lage en svarrapport per medikament? Tolkningene har relevans i lang tid, ikke bare de første månedene etter prøvetakning Må i så fall alle genetiske svarrapporter memoreres for hver pasient? Alle kjente fysiologiske mekanismer er i prinsippet berørt Skal de genetiske svarrapportene ha sin egen subjournal?

22 Utfordringer for kliniske IKT-systemer (2) Tolkningene av funnene må formidles dit beslutningene tas Eks. legges inn i beslutningsstøtte Eks. automatisk oppslag eller infobuttons Klinisk innhold må struktureres både i rapportene og i mottakende systemer Angivelse av de genetiske variantene tolkningen er bygget på Integrasjon med eksisterende pasientopplysninger Familietrær og arvelige sykdommer Fysiologiske variabler (blodtrykk, vekt, høyde) Angivelse av anbefaling etter tolkningen Legemidler og annen behandling Laboratorieundersøkelser og andre supplerende undersøkelser Differensialdiagnoser, angivelse av risiko for tilstander Påvirkning av tolkninger i andre former for beslutningsstøtte

23 Oppsummering Kunnskapen om genene er økende, og har betydning for behandling, diagnostikk, prognose og sykdomsrisiko Sekvensering og formidling av hele pasientgenom gir tekniske og sikkerhetsmessige utfordringer Jmf. pasientens rett til ikke å vite Jmf. krav om pasientsamtykke før undersøkelse Obs uærlige ansatte Visse gener sier noe om sykdomsrisiko mens andre sier noe om hva slags behandling pasienten skal ha. I lovverket behandles begge deler likt. Inntil en egen forskrift kommer Tolkning og forvaltning av informasjonen representerer medisinske utfordringer Enhver beslutningsstøtte eller protokoll i EPJ må ta høyde for individuelle (les: genetiske) forskjeller.

24 Her bruker genetikere Her bestiller og brukeren rapporter Arkitektur bioinformatikere som egne for er verktøy relevante plattform utredning og behandling, og legger evt. inn Her identifiseres for å tolke sekvensdataene om sekvensfragmentene fra de rådataene, automatiske tilleggsopplysninger tolkningene ikke som kreves for å deretter hvilke genvarianter gir resultat tolke de genetiske dataene pasienten har. Sekvenser Her og produseres rapporter med varianter lagres og gjøres tilgjengelig tolkning av hva pasientens for øvrige deler av systemet genvarianter betyr for sykdomsrisiko, diagnostikk, behandling, og prognose

Genetiske undersøkelser av biologisk materiale

Genetiske undersøkelser av biologisk materiale Genetiske undersøkelser av biologisk materiale Torunn Fiskerstrand, overlege PhD Senter for klinisk medisin og molekylærmedisin, Haukeland Universitetssykehus Institutt for klinisk medisin, Universitetet


Genetikk og persontilpasset medisin Ny teknologi nye muligheter og nye utfordringer

Genetikk og persontilpasset medisin Ny teknologi nye muligheter og nye utfordringer Genetikk og persontilpasset medisin Ny teknologi nye muligheter og nye utfordringer Dag Undlien Avdeling for medisinsk genetikk Oslo Universitetssykehus d.e.undlien@medisin.uio.no Dep of Medical Genetics


Høringsnotat. Forskrift om farmakogenetiske undersøkelser

Høringsnotat. Forskrift om farmakogenetiske undersøkelser Høringsnotat Helse- og omsorgsdepartementet Forskrift om farmakogenetiske undersøkelser Side 1 av 7 1 Hovedinnhold Helse- og omsorgsdepartementet foreslår i dette høringsnotatet en ny forskrift som skal


Persontilpasset medisin. Dag Undlien Avdeling for medisinsk genetikk Oslo Universitetssykehus og Universitetet i Oslo

Persontilpasset medisin. Dag Undlien Avdeling for medisinsk genetikk Oslo Universitetssykehus og Universitetet i Oslo Persontilpasset medisin Dag Undlien Avdeling for medisinsk genetikk Oslo Universitetssykehus og Universitetet i Oslo Persontilpasset medisin skjer i norske sykehus i dag Gleevec ved leukemi Herceptin og


Nasjonal DNA sekvensdata IT plattform for helsevesenet- genap. Store data møter medisinen 1. september 2015

Nasjonal DNA sekvensdata IT plattform for helsevesenet- genap. Store data møter medisinen 1. september 2015 Nasjonal DNA sekvensdata IT plattform for helsevesenet- genap Store data møter medisinen 1. september 2015 1 Målsetning med prosjektet Prosjektets målsetning er å utvikle en IKT infrastruktur for sentral,


Gentester del II: hvordan skal REK forholde seg til bruk av genetiske undersøkelser i forskningsprosjekter? Jakob Elster REK sør-øst

Gentester del II: hvordan skal REK forholde seg til bruk av genetiske undersøkelser i forskningsprosjekter? Jakob Elster REK sør-øst Gentester del II: hvordan skal REK forholde seg til bruk av genetiske undersøkelser i forskningsprosjekter? Jakob Elster REK sør-øst Oppsummering: etiske utfordringer ved genetiske undersøkelser Gentester


Arketyper. Hallvard Lærum, dr.med. Leder, Nasjonalt redaksjonsutvalg for Arketyper NIKT Fagansvarlig Klinisk IKT, OUS

Arketyper. Hallvard Lærum, dr.med. Leder, Nasjonalt redaksjonsutvalg for Arketyper NIKT Fagansvarlig Klinisk IKT, OUS Arketyper Hallvard Lærum, dr.med. Leder, Nasjonalt redaksjonsutvalg for Arketyper NIKT Fagansvarlig Klinisk IKT, OUS Status for EPJ EPJ er dominert av fritekst Stasjonær, tekstdominert elektronisk pasientjournal


Godkjenning av farmakogenetiske undersøkelser i forskning

Godkjenning av farmakogenetiske undersøkelser i forskning Sosial- og helsedirektoratet Pb 8054 Dep 0031 Oslo Deres ref.: 03/2591 T/TS/AFO Vår ref.: 03/43-002 Dato: 10.10.2003 Godkjenning av farmakogenetiske undersøkelser i forskning Bioteknologinemnda viser til


Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling?

Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling? Genfeil i kreftsvulster nøkkelen til en mer persontilpasset behandling? Hege G. Russnes Forsker ved Avd. For Genetikk, Institutt for Kreftforskning og overlege ved Avd. For Patologi Oslo Universitetssykehus


Genetisk testing. Genetisk testing. Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer

Genetisk testing. Genetisk testing. Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer NTNU Genetisk testing 1 Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer 2 Genetisk testing Formålet med genetisk testing er: finne den genetiske årsaken til tilstanden


Persontilpasset medisin og sjeldne diagnoser

Persontilpasset medisin og sjeldne diagnoser Man skal ikke skjære alle over én kam Persontilpasset medisin og sjeldne diagnoser Benedicte Paus vdeling for medisinsk genetikk, Oslo universitetssykehus Institutt for klinisk medisin, Universitetet i


Dypsekvensering. Next generation sequencing (NGS) High throughput sequencing (HTS)

Dypsekvensering. Next generation sequencing (NGS) High throughput sequencing (HTS) Dypsekvensering Next generation sequencing (NGS) High throughput sequencing (HTS) Bioingeniørkongressen 03.06.2016 Eidi Nafstad Avdelingsingeniør Avdeling for medisinsk genetikk, OUS Kromosomer og DNA


Genetikkens plass i klinikken noen overordnede tanker

Genetikkens plass i klinikken noen overordnede tanker Genetikkens plass i klinikken noen overordnede tanker Trine Prescott Overlege Seksjon for klinisk genetikk Avdeling for medisinsk genetikk Oslo Universitetssykehus / Rikshospitalet 07.01.09 1 Huntington


Et vanskelig valg. Huntingtons sykdom. Informasjon om presymptomatisk test

Et vanskelig valg. Huntingtons sykdom. Informasjon om presymptomatisk test Et vanskelig valg Huntingtons sykdom Informasjon om presymptomatisk test Utgitt av Landsforeningen for Huntingtons sykdom i samarbeid med Senter for sjeldne diagnoser Et vanskelig valg Innhold Hva kan


Psykisk utviklingshemming. Gertraud Leitner Barnelege HABU SSK

Psykisk utviklingshemming. Gertraud Leitner Barnelege HABU SSK Gertraud Leitner Barnelege HABU SSK Utredning Anamnese Familie Svangerskap, fødsel Utvikling Sykdommer Informasjon fra skolen og barnehagen Klinisk undersøkelse Avdekke tilstander Utseende: spesielle kjennetegn


Forskning på barn, spesielt genetisk forskning. Arvid Heiberg Overlege, professor (em) Avdeling for medisinsk genetikk OUS, Rikshospitalet.

Forskning på barn, spesielt genetisk forskning. Arvid Heiberg Overlege, professor (em) Avdeling for medisinsk genetikk OUS, Rikshospitalet. Forskning på barn, spesielt genetisk forskning Arvid Heiberg Overlege, professor (em) Avdeling for medisinsk genetikk OUS, Rikshospitalet. Barn som sårbar gruppe Alle barn er definert som sårbare forskningsmessig,


Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser

Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser PEDENDO_SISTE_slutt.qxd 18.12.2003 21:34 Side 32 Pediatrisk Endokrinologi 2003;17: 34-38 Klinisk molekylærmedisin (4): Indirekte diagnostikk ved koblingsanalyser Pål Rasmus Njølstad 1,2,3,Jørn V. Sagen


Høring - Utkast til forskrift om innsamling og behandling av helseopplysninger i nasjonalt register over hjerte- og karlidelser

Høring - Utkast til forskrift om innsamling og behandling av helseopplysninger i nasjonalt register over hjerte- og karlidelser Helse- og omsorgsdepartementet Pb. 8011 Dep 0030 Oslo Deres ref: 201101355-/SVE Vår ref: 2011/64 Dato: 12. oktober 2011 Høring - Utkast til forskrift om innsamling og behandling av helseopplysninger i


Inni er vi like - eller er vi det? Psykofarmakologisk utfordringer. Variasjon. Utfordringer ved etnisitet (genetikk) og farmakologisk behandling

Inni er vi like - eller er vi det? Psykofarmakologisk utfordringer. Variasjon. Utfordringer ved etnisitet (genetikk) og farmakologisk behandling 13.02.2015 1 FORSVARET Forsvarets sanitet Inni er vi like - eller er vi det? Utfordringer ved etnisitet (genetikk) og farmakologisk behandling Dag Kristen Solberg Spesialist i psykiatri og klinisk farmakologi


Et vanskelig valg. Huntingtons sykdom. Informasjon om presymptomatisk test

Et vanskelig valg. Huntingtons sykdom. Informasjon om presymptomatisk test Et vanskelig valg Huntingtons sykdom Informasjon om presymptomatisk test Utgitt av Landsforeningen for Huntingtons sykdom i samarbeid med Senter for sjeldne diagnoser Et vanskelig valg Innhold Hva kan


Den genetiske revolusjon til nytte for meg?

Den genetiske revolusjon til nytte for meg? Den genetiske revolusjon til nytte for meg? Gunnar Houge Seksjonsleder/overlege Senter for medisinsk genetikk og molekylærmedisin Haukeland Universitetssykehus Hvor ofte har utviklingshemning genetisk


Personvern og tilgang i journal Internt & Eksternt. Helge Veum, senioringeniør HelsIT, Trondheim, 25. september 2008

Personvern og tilgang i journal Internt & Eksternt. Helge Veum, senioringeniør HelsIT, Trondheim, 25. september 2008 Personvern og tilgang i journal Internt & Eksternt Helge Veum, senioringeniør HelsIT, Trondheim, 25. september 2008 1. Personvern Mer enn hindre tilgang Mer enn informasjonssikkerhet Sentrale element:


Vedlegg 1: Detaljerte resultater for landene

Vedlegg 1: Detaljerte resultater for landene Vedlegg 1: Detaljerte resultater for landene Spørsmål 1 Generelt syn på helsevesenet Zealand Sveits Alt i alt ganske bra 62,0 45,1 40,3 37,4 55,4 53,1 46,3 22,6 46,1 14,8 Grunnleggende endringer nødvendig


Ny lov nye muligheter for deling av pasientopplysninger

Ny lov nye muligheter for deling av pasientopplysninger Ny lov nye muligheter for deling av pasientopplysninger - regelverksendringene - felles journal i Helse Nord 17.09.15 - STYRK Årskonferanse 2015 Juridisk rådgiver Heidi Talsethagen, FIKS Fra én journal


Lovlig journalbruk Oppslag i og bruk av Pasientjournalen

Lovlig journalbruk Oppslag i og bruk av Pasientjournalen Lovlig journalbruk Oppslag i og bruk av Pasientjournalen 1 Oppslag i og bruk av pasientjournalen Journalen er et viktig verktøy for tilgang til og deling av informasjon mellom samhandlende helsepersonell.


Blau Syndrom/ Juvenil Sarkoidose

Blau Syndrom/ Juvenil Sarkoidose www.printo.it/pediatric-rheumatology/no/intro Blau Syndrom/ Juvenil Sarkoidose Versjon av 2016 1. HVA ER BLAU SYNDROM/ JUVENIL SARKOIDOSE 1.1 Hva er det? Blau syndrom er en genetisk sykdom. Sykdommen gir


Genene mine og meg hva bør jeg passe på?

Genene mine og meg hva bør jeg passe på? 1 Genene mine og meg hva bør jeg passe på? Berge Solberg, professor i medisinsk etikk, Norges Teknisk Naturvitenskapelige Universitet, Medlem av Bioteknologinemnda i Norge 2 Genavlesning / sekvensering


Pasientsikkerhet Hva innebærer det, og hvem er bidragsyterne? Steinar Madsen Medisinsk fagdirektør

Pasientsikkerhet Hva innebærer det, og hvem er bidragsyterne? Steinar Madsen Medisinsk fagdirektør Pasientsikkerhet Hva innebærer det, og hvem er bidragsyterne? Steinar Madsen Medisinsk fagdirektør Fra legemiddel til pasient Godkjenning Lege/ sykehus Apotek Pasient Utprøving Legemiddelindustri Legemiddelverket


Periodisk NLRP 12-Forbundet Feber

Periodisk NLRP 12-Forbundet Feber www.printo.it/pediatric-rheumatology/no/intro Periodisk NLRP 12-Forbundet Feber Versjon av 2016 1. HVA ER PERIODISK NLRP 12-FORBUNDET FEBER 1.1 Hva er det? Sykdommen er arvelig. Det endrede genet ansvarlig


Hvordan skal vi sikre god diabetesdiagnostikk ved hjelp av HbA1c?

Hvordan skal vi sikre god diabetesdiagnostikk ved hjelp av HbA1c? Hvordan skal vi sikre god diabetesdiagnostikk ved hjelp av HbA1c? NFMBs og NSMBs Høstmøte 2012 Trondheim, den 8-10. oktober 2012 Jens P Berg Avdeling for medisinsk biokjemi Institutt for klinisk medisin,


Alt for lange journaler truer pasientsikkerhet

Alt for lange journaler truer pasientsikkerhet Tverrfaglig EPJ Pasienten i sentrum? Sidsel R. Børmark, anestesisykepleier, PhD Delprosjektleder Klinisk Dokumentasjon Sykepleie KDS Regional EPJ ved OUS Alt for lange journaler truer pasientsikkerhet


Hurtigtesten som utføres per i dag. Åpent møte 7 januar 2008 Gentesting ved bryst- og eggstokkreft

Hurtigtesten som utføres per i dag. Åpent møte 7 januar 2008 Gentesting ved bryst- og eggstokkreft Hurtigtest egnet for formålet? Åpent møte 7 januar 2008 Gentesting ved bryst- og eggstokkreft Overlege dr philos Torunn Fiskerstrand Haukeland Universitetssykehus Hurtigtesten som utføres per i dag 23



HVEM ER JEG OG HVOR «BOR» JEG? DISCLAIMER HVEM ER JEG OG HVOR «BOR» JEG? INFORMASJONSSIKKERHET Konfidensialitet Sikre at informasjon bare er tilgjengelig for de som skal ha tilgang Integritet Sikre informasjon mot utilsiktet eller


Hva skal til? Elementer til en handlingsplan for prosesstøttende EPJ. dr.med. Hallvard Lærum Klinisk IKT fagforum

Hva skal til? Elementer til en handlingsplan for prosesstøttende EPJ. dr.med. Hallvard Lærum Klinisk IKT fagforum Hva skal til? Elementer til en handlingsplan for prosesstøttende EPJ dr.med. Hallvard Lærum Klinisk IKT fagforum Hva er Klinisk IKT-forum? Representanter fra hver helseregion med særskilt bakgrunn i helseinformatikk


Lovlig journalbruk Oppslag i og bruk av pasientjournalen

Lovlig journalbruk Oppslag i og bruk av pasientjournalen Lovlig journalbruk Oppslag i og bruk av pasientjournalen Stab fag og pasientsikkerhet Seksjon for personvern og informasjonssikkerhet OPPSLAG I OG BRUK AV PASIENTJOURNALEN Journalen er et viktig verktøy


I lys av akkreditering Overgang fra Sanger sekvensering til dypsekvensering innen genetisk sykdomsdiagnostikk

I lys av akkreditering Overgang fra Sanger sekvensering til dypsekvensering innen genetisk sykdomsdiagnostikk I lys av akkreditering Overgang fra Sanger sekvensering til dypsekvensering innen genetisk sykdomsdiagnostikk Knut Erik Berge, Avdeling for medisinsk genetikk, Oslo universitetssykehus Ullevål Agenda DNA


Hvordan håndtere en mulig avvikende metadonmetabolisme? Fatemeh Chalabianloo Avdeling for rusmedisin Haukeland Universitetssykehus

Hvordan håndtere en mulig avvikende metadonmetabolisme? Fatemeh Chalabianloo Avdeling for rusmedisin Haukeland Universitetssykehus Hvordan håndtere en mulig avvikende metadonmetabolisme? Fatemeh Chalabianloo Avdeling for rusmedisin Haukeland Universitetssykehus FORSLAG FOR FREMGANGSMÅTE VED MISTANKE OM AVVIKENDE METADONMETABOLISME


Studenters tilgang til elektronisk pasientjournal

Studenters tilgang til elektronisk pasientjournal Studenters tilgang til elektronisk pasientjournal Helge Grimnes Personvernrådgiver Stab pasientsikkerhet og kvalitet Oslo universitetssykehus HF Seksjon for informasjonssikkerhet og personvern Helsepersonell,


Planlagt behandling i følgende utvalg: Sak nr.: Møtedato: Votering: PILOTOERING AV NASJONAL KJERNEJOURNAL I STAVANGER, SOLA OG RANDABERG

Planlagt behandling i følgende utvalg: Sak nr.: Møtedato: Votering: PILOTOERING AV NASJONAL KJERNEJOURNAL I STAVANGER, SOLA OG RANDABERG Saksframlegg STAVANGER KOMMUNE REFERANSE JOURNALNR. DATO ERA1-12/6250-11 84173/13 29.11.2013 Planlagt behandling i følgende utvalg: Sak nr.: Møtedato: Votering: Eldrerådet 10.12.2013 Innvandrerrådet 11.12.2013


Forslag til nasjonal metodevurdering

Forslag til nasjonal metodevurdering Forslagsskjema, Versjon 2 17. mars 2014 Forslag til nasjonal metodevurdering Innsendte forslag til nasjonale metodevurderinger vil bli publisert i sin helhet. Dersom forslagsstiller mener det er nødvendig


Veileder Forberedende samtaler; felles planlegging av tiden fremover og helsehjelp ved livets slutt

Veileder Forberedende samtaler; felles planlegging av tiden fremover og helsehjelp ved livets slutt Veileder Forberedende samtaler; felles planlegging av tiden fremover og helsehjelp ved livets slutt Planlagte forberedende samtaler En planlagt forberedende samtale innebærer at pasient og/eller pårørende


Hva bør pasienten teste selv?

Hva bør pasienten teste selv? Hva bør pasienten teste selv? Steinar Madsen Medisinsk fagdirektør Statens legemiddelverk Optimisme I år 2000 vil de sykdommene som tar livet av flest mennesker slik som hjertesykdom, slag, lungesykdom


Til pasienter som skal gjennomgå transplantasjon med nyre fra avdød giver.

Til pasienter som skal gjennomgå transplantasjon med nyre fra avdød giver. VEDLEGG 7 Forespørsel om deltakelse i forskningsprosjektet Til pasienter som skal gjennomgå transplantasjon med nyre fra avdød giver. Studiens navn: Organdonasjon med bruk av Ekstra Corporal Membran Oksygenator


Bedre helse og sikkerhet med EPJ

Bedre helse og sikkerhet med EPJ Bedre helse og sikkerhet med EPJ Helsit, 27. september 2007 Tor Arne Viksjø Adm. dir. DIPS ASA Mine tema Noen ord om hvem vi er Datasikkerheten med og uten EPJ Tilgangskontrollen i DIPS En kronikk i Aftenposten


Haukeland og Haraldsplass

Haukeland og Haraldsplass Haukeland og Haraldsplass En historie fra virkeligheten Lars Birger Nesje Avdelingssjef dr. med. Medisinsk avdeling Haukeland Universitetssykehus HelsIT, Trondheim 27.09.2006 Agenda: Haukeland og Haraldsplass


Fagruppe molekylær patologi

Fagruppe molekylær patologi Fagruppe molekylær patologi Aktuelt faglig nytt Hege G. Russnes Årsmøte, Patologforeningen OUS 18.03.2015 Faggruppe molekylærpatologi Hege G. Russnes, Oslo Olav Vintermyr, Bergen Sonja Steigen, Tromsø


Registrering og innsamling av helsedata sett opp mot IT - sikkerhet Kvalitetsregisterkonferanse Tromsø

Registrering og innsamling av helsedata sett opp mot IT - sikkerhet Kvalitetsregisterkonferanse Tromsø Registrering og innsamling av helsedata sett opp mot IT - sikkerhet Kvalitetsregisterkonferanse Tromsø 22.09.2008 Per Olav Skjesol Avdelingsleder anvendelse og leder NIKT Fagforum for arkitektur Sikkerhet


Sviktende tilgangsstyring i elektroniske pasientjournaler? Ragnhild Castberg, seniorådgiver Norsk Arkivråds arkivseminar,18.

Sviktende tilgangsstyring i elektroniske pasientjournaler? Ragnhild Castberg, seniorådgiver Norsk Arkivråds arkivseminar,18. Sviktende tilgangsstyring i elektroniske pasientjournaler? Ragnhild Castberg, seniorådgiver Norsk Arkivråds arkivseminar,18.september 2012 Om Datatilsynet Et forvaltningsorgan med stor grad av faglig uavhengighet


Når gamle blir syke. 17. oktober, 2003. Morten Mowe Seksjonsoverlege, dr.med Aker universitetssykehus

Når gamle blir syke. 17. oktober, 2003. Morten Mowe Seksjonsoverlege, dr.med Aker universitetssykehus Når gamle blir syke. 17. oktober, 2003 Morten Mowe Seksjonsoverlege, dr.med Aker universitetssykehus Tidens gang De ensomme gamle Tiedeman, Nasjonalgalleriet Aging is a barbaric phenomenon that shouldn't


Retningslinjer for oppstart behandling av medfødt hypotyreose med utgangspunkt i et positivt screeningfunn.

Retningslinjer for oppstart behandling av medfødt hypotyreose med utgangspunkt i et positivt screeningfunn. Retningslinjer for oppstart behandling av medfødt hypotyreose med utgangspunkt i et positivt screeningfunn. Medisinsk ansvarlig lege (Nyfødtscreeningen), T: 23073179/23072791 evt 23070000, calling 26923/22791.


Krever genetiske data særbehandling?

Krever genetiske data særbehandling? Krever genetiske data særbehandling? Heidi Beate Bentzen Senter for rettsinformatikk, Det juridiske fakultet, Universitetet i Oslo Hva er et genom? Hva er et genom? Genom: En organismes komplette sett


Praktisk bruk av kjernejournal

Praktisk bruk av kjernejournal Praktisk bruk av kjernejournal Lommemanual for helsepersonell Kjernejournal er en ny elektronisk løsning som samler viktige helseopplysninger om pasienten på ett sted Når du trenger informasjon for å yte


Familiær Middelhavsfeber (FMF)

Familiær Middelhavsfeber (FMF) www.printo.it/pediatric-rheumatology/no/intro Familiær Middelhavsfeber (FMF) Versjon av 2016 2. DIAGNOSE OG BEHANDLING 2.1 Hvordan stilles diagnosen? Generelt følger man denne tilnærmingen: Klinisk mistanke:


Trening øker gjenvinning i celler Natur og miljø

Trening øker gjenvinning i celler Natur og miljø Forskningsnyheter om Huntingtons sykdom. I et lettfattelig språk. Skrevet av forskere. Til det globale HS-fellesskapet. Trening øker gjenvinning i celler Trening øker cellulær gjenvinning hos mus. Er det


Samhandlingskjeder og pasientforløp. Utfordringer i forhold til kronisk syke og eldre. Foto: Helén Eliassen

Samhandlingskjeder og pasientforløp. Utfordringer i forhold til kronisk syke og eldre. Foto: Helén Eliassen Orkdal 24.03.10 Tove Røsstad Samhandlingskjeder og pasientforløp. Utfordringer i forhold til kronisk syke og eldre. Foto: Helén Eliassen Hva menes med samhandling? Samhandling er uttrykk for helse- og


Prioritering som lederu/ordring

Prioritering som lederu/ordring Prioritering som lederu/ordring NSH Lederkonferansen 2013 Sigbjørn Smeland Klinikkleder Kre?-, kirurgi- og transplantasjonsklinikken Oslo universitetssykehus Ansvarsområde i OUS (blant annet) Kre?behandling


Har jeg arvelig disposisjon for hjertesykdom?

Har jeg arvelig disposisjon for hjertesykdom? Har jeg arvelig disposisjon for hjertesykdom? Nina Øyen Senter for medisinsk gene?kk og molekylærmedisin, Haukeland universitetssykehus & Ins?tuE for global helse og samfunnsmedisin, Universitetet i Bergen


Innføring i Good Clinical Practice (GCP) og hva er spesielt hos barn?

Innføring i Good Clinical Practice (GCP) og hva er spesielt hos barn? Innføring i Good Clinical Practice (GCP) og hva er spesielt hos barn? Martha Colban, Avdelingsleder Avdeling for klinisk forskningsstøtte Virksomhetsområde forskningsstøtte Oslo universitetssykehus HF


Pakkeforløp i Helse Vest. 18.03.15. Baard-Christian Schem Fagdirektør, Helse Vest RHF

Pakkeforløp i Helse Vest. 18.03.15. Baard-Christian Schem Fagdirektør, Helse Vest RHF Pakkeforløp i Helse Vest 18.03.15. Baard-Christian Schem Fagdirektør, Helse Vest RHF Mål for utredning er : Skreddersydd behandling Kreftbehandling gir ofte betydelige skader Akkurat nok, mindre marginer


Status, fremdrift og mål for Prioriteringsutvalget

Status, fremdrift og mål for Prioriteringsutvalget PRIORITERINGSUTVALGET Et offentlig utvalg oppnevnt av Helse- og omsorgsdepartementet for å vurdere spørsmål knyttet til prioritering i helsesektoren Status, fremdrift og mål for Prioriteringsutvalget Ole


God helse - gode liv! Verdien av tilrettelagt fysisk aktivitet i psykisk helsearbeid. Assisterende helsedirektør Øystein Mæland

God helse - gode liv! Verdien av tilrettelagt fysisk aktivitet i psykisk helsearbeid. Assisterende helsedirektør Øystein Mæland God helse - gode liv! Verdien av tilrettelagt fysisk aktivitet i psykisk helsearbeid Assisterende helsedirektør Øystein Mæland Oslo Universitetssykehus, Gaustad, 4. september 2013 Bakteppe: Forventet levetid



www.printo.it/pediatric-rheumatology/no/intro www.printo.it/pediatric-rheumatology/no/intro Majeed Versjon av 2016 1. HVA ER MAJEED SYNDROM? 1.1 Hva er det? Majeed syndrom er en sjelden genetisk sykdom. Pasientene har kronisk tilbakevendende multifokal


Hvordan kan personvernet ivaretas i helsesektoren?

Hvordan kan personvernet ivaretas i helsesektoren? Hvordan kan personvernet ivaretas i helsesektoren? Bjørn Erik Thon direktør 06.10.2011 Side 1 Hva er personvern? - Noen viktige ord personverntanken. - Samtykke - Informasjon og innsyn - Selvbestemmelse/autonomi


BCG-vaksinasjon i første leveår: ny anbefaling om å vaksinere ved alder 6 uker

BCG-vaksinasjon i første leveår: ny anbefaling om å vaksinere ved alder 6 uker BCG-vaksinasjon i første leveår: ny anbefaling om å vaksinere ved alder 6 uker Tuberkulose og BCG-vaksinasjon 600 500 400 300 200 100 0 Totalt Norskfødte Utenlandsfødte Fra sommeren 2009 ble BCG-vaksine


Autismespekterforstyrrelser Sentrale utfordringer

Autismespekterforstyrrelser Sentrale utfordringer 1 Modeller for å forstå Sentrale utfordringer Terje Nærland Psykolog / PhD Forsker: Leder: NevSom Nasjonal kompetansesenter for nevroutviklingsforstyrrelser og hypersomnier, OUS SFF NORMENT - K.G. Jebsen


Helseopplysninger på tvers - rammer for deling og tilgang HelsIT. 15. oktober 2014 Marius Engh Pellerud

Helseopplysninger på tvers - rammer for deling og tilgang HelsIT. 15. oktober 2014 Marius Engh Pellerud Helseopplysninger på tvers - rammer for deling og tilgang HelsIT 15. oktober 2014 Marius Engh Pellerud Hva er personvern? 18.06.2014 Side 2 Retten til privatliv Selvbestemmelse Rett til å vite og forstå


AUDIT: P-PILLER. Utarbeidet av: Stine Figenschau og Kine Østnes Hanssen. På vegne av: Kull-05 Institutt for farmasi Universitetet i Tromsø

AUDIT: P-PILLER. Utarbeidet av: Stine Figenschau og Kine Østnes Hanssen. På vegne av: Kull-05 Institutt for farmasi Universitetet i Tromsø AUDIT: P-PILLER Utarbeidet av: Stine Figenschau og Kine Østnes Hanssen På vegne av: Kull-05 Institutt for farmasi Universitetet i Tromsø Hva er en audit? Audit er en revisjon Klinisk audit er en kvalitetsforbedrene


Hvis helseregisterloven 13 ikke fantes hva så?: Tilgang til journalopplysninger. trengs

Hvis helseregisterloven 13 ikke fantes hva så?: Tilgang til journalopplysninger. trengs Hvis helseregisterloven 13 ikke fantes hva så?: Tilgang til journalopplysninger der det trengs, når det trengs Ellen K.Christiansen Seniorrådgiver Nasjonalt senter for telemedisin Ellen.Christiansen@telemed.no


Hvem er dette heftet beregnet på?

Hvem er dette heftet beregnet på? Kronisk nyresvikt Hvem er dette heftet beregnet på? Dette heftet er ment til deg som helsepersonell og er et verktøy ved opplæring og dialog med omsorgspersoner og foreldre til barn med kronisk nyresvikt.



Barnediabetesregisteret Forespørsel om deltakelse i Barnediabetesregisteret Nasjonalt medisinsk kvalitetsregister for barne- og ungdomsdiabetes og forskningsprosjektet Studier av diabetes hos barn og unge: Betydning av arvemessige


Dø av eller dø med? Om eldre, hjertesvikt og livskvalitet

Dø av eller dø med? Om eldre, hjertesvikt og livskvalitet Dø av eller dø med? Om eldre, hjertesvikt og livskvalitet Steinar Madsen Medisinsk fagdirektør og avtalespesialist i indremedisin og hjertesykdommer Den gamle (hjerte)pasienten Man skiller ikke mellom



RIKTIG LEGEMIDDELBRUK I SYKEHJEM RIKTIG LEGEMIDDELBRUK I SYKEHJEM LEGEMIDDELGJENNOMGANGER HVA ER EN LEGEMIDDELGJENNOMGANG? LMG er en strukturert metode for å gå igjennom enkeltpasienters totale legemiddelbruk slik at denne blir best mulig


Levermetabolisme og farmakokinetiske interaksjoner med hovedvekt på CYP-systemet

Levermetabolisme og farmakokinetiske interaksjoner med hovedvekt på CYP-systemet Levermetabolisme og farmakokinetiske interaksjoner med hovedvekt på CYP-systemet Ketil Arne Espnes Spesialist i allmennmedisin Spesialist i klinisk farmakologi Seksjonsoverlege Avdeling for klinisk farmakologi


Viktige verdivalg. Gentesting ved bryst- og eggstokkreft. Bjørn K. Myskja Filosofisk institutt NTNU. Helse som gode

Viktige verdivalg. Gentesting ved bryst- og eggstokkreft. Bjørn K. Myskja Filosofisk institutt NTNU. Helse som gode Viktige verdivalg Gentesting ved bryst- og eggstokkreft Bjørn K. Myskja Filosofisk institutt NTNU 1 Helse som gode God helse ett viktig aspekt ved et godt liv Tiltak som kan bidra til redusert lidelse


Legemiddelbruk hos eldre Dagskurs i sykehjemsmedisin, Hamar 140513

Legemiddelbruk hos eldre Dagskurs i sykehjemsmedisin, Hamar 140513 Legemiddelbruk hos eldre Dagskurs i sykehjemsmedisin, Hamar 140513 Torgeir Bruun Wyller Professor/overlege Geriatrisk avdeling, Ullevål For mye brukt For lite brukt ACE-hemmer Antitrombotika Betablokkere


Ernæringsstrategi Oslo universitetssykehus HF 2014 2018

Ernæringsstrategi Oslo universitetssykehus HF 2014 2018 1 Ernæringsstrategi Oslo universitetssykehus HF 2014 2018 Utarbeidet av Ernæringsrådet ved Oslo universitetssykehus HF 2 Bakgrunn Ernæringsstrategien for Oslo universitetssykehus HF (OUS) bygger på sykehusets


Gensaksen CRISPR - Når ivlet. Sigrid B. Thoresen, Seniorrådgiver i Bioteknologirådet

Gensaksen CRISPR - Når ivlet. Sigrid B. Thoresen, Seniorrådgiver i Bioteknologirådet Gensaksen CRISPR - Når ivlet kan l i v e t redigeres Sigrid B. Thoresen, Seniorrådgiver i Bioteknologirådet Genterapi /Genmodifisering Editing humanity The life editor The age of the red pen CRISPR, the


Hvordan vil helsedata kunne være en ressurs for persontilpasset medisin?

Hvordan vil helsedata kunne være en ressurs for persontilpasset medisin? Hvordan vil helsedata kunne være en ressurs for persontilpasset medisin? Dag Undlien Avdeling for medisinsk genetikk Oslo Universitetssykehus d.e.undlien@medisin.uio.no Dep of Medical Genetics Persontilpasset


Madeleine Fannemel Avd for medisinsk genetikk

Madeleine Fannemel Avd for medisinsk genetikk Madeleine Fannemel Avd for medisinsk genetikk www.genetikkportalen.no/ Norsk portal for medisinsk-genetiske analyser. Oversikt over hvilke laboratorier som gjør de ulike analyser. Avd for medisinsk genetikk


Anne Anderssen - Prosjektleder EPJ Utvikling. Norsk Arkivråd seminar - Oslo 17 september 2012

Anne Anderssen - Prosjektleder EPJ Utvikling. Norsk Arkivråd seminar - Oslo 17 september 2012 Anne Anderssen - Prosjektleder EPJ Utvikling Norsk Arkivråd seminar - Oslo 17 september 2012 Formål med foredraget Ta dere med på en visning av morgendagens EPJ og hvordan vi tenker den skal fungere «Dagens


Grenseløs forskning. Status og behov for forskning på sjeldne tilstander

Grenseløs forskning. Status og behov for forskning på sjeldne tilstander Grenseløs forskning Status og behov for forskning på sjeldne tilstander Benedicte Paus Overlege, avdeling for medisinsk genetikk, OUS Professor i klinisk genetikk, UIO Forskning på sjeldne tilstander Forskning


Legemidler er et av de viktigste redskapene vi har i helsevesenet for å behandle, lindre og forebygge sykdom og plager. Men brukt feil kan de skade

Legemidler er et av de viktigste redskapene vi har i helsevesenet for å behandle, lindre og forebygge sykdom og plager. Men brukt feil kan de skade Kvinners legemiddelbruk med fokus på svangerskap kunnskapshull Hedvig Nordeng Professor Farmasøytisk institutt Universitetet i Oslo Legemidler er et av de viktigste redskapene vi har i helsevesenet for


Genetisk testing for helseformål

Genetisk testing for helseformål Genetisk testing for helseformål I HVILKE SITUASJONER VIL MAN OVERVEIE EN GENETISK TEST? FAGLIG GENETISK RÅDGIVNING HVA LETER MAN ETTER I EN GENETISK TEST? DIN BESLUTNING Genetisk testing for helseformål


Når noen i familien er syke påvirker det hele familien. Dette gjelder både fysiske og psykiske sykdommer.

Når noen i familien er syke påvirker det hele familien. Dette gjelder både fysiske og psykiske sykdommer. Dette er sider for deg som er forelder og sliter med psykiske problemer Mange har problemer med å ta vare op barna sine når de er syke Det er viktig for barna at du forteller at det er sykdommen som skaper


Tilrettelegging av kvalitetsregistre for forskning

Tilrettelegging av kvalitetsregistre for forskning Tilrettelegging av kvalitetsregistre for forskning LMI, 25. mai 2010 Wenche Reed Seksjonsleder Biobank og registerstøtte Oslo universitetssykehus UUS OUS Aker v i k Radiumhospitalet Rikshospitalet v Helse


Risikolegemidler. Laila Bruun Sykehusfarmasøyt. Seksjon for Legemiddelkomite og sikkerhet Avd for farmakologi OUS

Risikolegemidler. Laila Bruun Sykehusfarmasøyt. Seksjon for Legemiddelkomite og sikkerhet Avd for farmakologi OUS Risikolegemidler Laila Bruun Sykehusfarmasøyt Seksjon for Legemiddelkomite og sikkerhet Avd for farmakologi OUS Risikolegemidler hva er det? Legemiddel som har medført alvorlig skade/dødsfall pga - Legemiddelets


Svangerskap og fertilitet ved CF. Fagkurs 2013

Svangerskap og fertilitet ved CF. Fagkurs 2013 Svangerskap og fertilitet ved CF Fagkurs 2013 1 Disposisjon I Svangerskap ved CF generelt Utfordringer for helse mor/ barn Informasjon/ planlegging Kontroll og oppfølging II Fertilitet hos menn 2 Statistikk


Innst. 275 S. (2014 2015) Innstilling til Stortinget fra helse- og omsorgskomiteen. Sammendrag. 2. Komiteens merknader. Dokument 8:66 S (2014 2015)

Innst. 275 S. (2014 2015) Innstilling til Stortinget fra helse- og omsorgskomiteen. Sammendrag. 2. Komiteens merknader. Dokument 8:66 S (2014 2015) Innst. 275 S (2014 2015) Innstilling til Stortinget fra helse- og omsorgskomiteen Dokument 8:66 S (2014 2015) Innstilling fra helse- og omsorgskomiteen om representantforslag fra stortingsrepresentantene


6 forord. Oslo, oktober 2013 Stein Andersson, Tormod Fladby og Leif Gjerstad

6 forord. Oslo, oktober 2013 Stein Andersson, Tormod Fladby og Leif Gjerstad [start forord] Forord Demens er en av de store utfordringene i moderne medisin. Vi vet at antallet mennesker som vil bli rammet av sykdommer som gir demens, antakelig vil dobles de neste to tiårene, og


Trygg bruk av nye legemidler Hvordan kan vi samarbeide til pasientens beste? Steinar Madsen Medisinsk fagdirektør

Trygg bruk av nye legemidler Hvordan kan vi samarbeide til pasientens beste? Steinar Madsen Medisinsk fagdirektør Trygg bruk av nye legemidler Hvordan kan vi samarbeide til pasientens beste? Steinar Madsen Medisinsk fagdirektør Håpet om vidundermedisin Nye medisiner nye problemer Manglende effekt Utvalgte pasienter


Nasjonal kjernejournal - helsepersonell og pasient på samme arena

Nasjonal kjernejournal - helsepersonell og pasient på samme arena Nasjonal kjernejournal - helsepersonell og pasient på samme arena Ingeborg Berge Sykepleier i avd. Kjernejournal Eresept Kjernejournal i pilot: Fastlegen ny pasient trenger resept på medisin hun ikke husker.


Være i stand til å identifisere situasjoner hvor det kan være aktuelt å bruke bestemmelsene i pasientrettighetsloven kap. 4A

Være i stand til å identifisere situasjoner hvor det kan være aktuelt å bruke bestemmelsene i pasientrettighetsloven kap. 4A Læringsmål Være i stand til å identifisere situasjoner hvor det kan være aktuelt å bruke bestemmelsene i pasientrettighetsloven kap. 4A Forstå hva som menes med begrepene helsehjelp og samtykkekompetanse,


Kvinne 30, Berit eksempler på globale skårer

Kvinne 30, Berit eksempler på globale skårer Kvinne 30, Berit eksempler på globale skårer Demonstrasjon av tre stiler i rådgivning - Målatferd er ikke definert. 1. Sykepleieren: Ja velkommen hit, fint å se at du kom. Berit: Takk. 2. Sykepleieren:


Forespørsel om deltakelse i forskningsprosjekt Hva er din holdning til testing for arvelige sykdommer? +

Forespørsel om deltakelse i forskningsprosjekt Hva er din holdning til testing for arvelige sykdommer? + Kodebok 10399 Instrumentelle og affektive holdninger til testing for ulike typer arvelige sykdommer Forespørsel om deltakelse i forskningsprosjekt Hva er din holdning til testing for arvelige sykdommer?


Bioteknologinemnda The Norwegian Biotechnology Advisory Board. Deres ref: Vår ref: 03/0043-649 Dato: 09.11.04

Bioteknologinemnda The Norwegian Biotechnology Advisory Board. Deres ref: Vår ref: 03/0043-649 Dato: 09.11.04 Bioteknologinemnda The Norwegian Biotechnology Advisory Board Forskningsreguleringsutvalget v/simonsen Sosial- og helsedirektoratet FSH Pb. 8054 Dep 0031 OSLO Deres ref: Vår ref: 03/0043-649 Dato: 09.11.04


IKT. for helsetjenesten. 5 løsningsprinsipper for bedre samhandling

IKT. for helsetjenesten. 5 løsningsprinsipper for bedre samhandling IKT for helsetjenesten 5 løsningsprinsipper for bedre samhandling 1 Dette er en oppsummering av tiltak 12 i handlingsplan for Nasjonal IKT, «Tjenesteorientert arkitektur for spesialisthelsetjenesten».


Personvern eller Digitale tjenester Ja, takk begge deler

Personvern eller Digitale tjenester Ja, takk begge deler Personvern eller Digitale tjenester Ja, takk begge deler Økonomiske Internett tjenester Hvordan reguleres og sikres disse Hvordan håndteres konsekvenser Bruk av Internett for informasjonstilgang innen


Én innbygger én journal

Én innbygger én journal Én innbygger én journal Seniorrådgiver Kirsten Petersen, avdeling e-helse. Desember 2013 Det overordnede utfordringsbildet er kjent Hovedutfordringer beskrevet i Meld. St. 9 Papir med strøm dagens løsning


Har vi for mange universitetssykehus? Dag Bratlid

Har vi for mange universitetssykehus? Dag Bratlid Dag Bratlid Institutt for laboratoriemedisin, barne- og kvinnesykdommer, NTNU, og Barne- og ungdomsklinikken, St. Olavs hospital, Trondheim 1 Hva er universitetssykehusenes primære oppgaver? Utdanne helsepersonell


LovLiG ung Informasjon om helserettigheter for ungdom

LovLiG ung Informasjon om helserettigheter for ungdom LovLiG ung Informasjon om helserettigheter for ungdom I Norge har vi en rekke lovbestemmelser som skal sikre alle lik tilgang til gode helsetjenester. For deg som er under 18 år og derfor regnes som mindreårig,
